Dataset for CDS PMAIP1 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q1NFP6_PMAIP1-      atgcctggaaggagggctcgtaagagcgcccagccgagccccacgcgggt
A0A4W2CDL0_PMAIP1-      atgcctggaaggagggctcgtaagagcgcccagccgagccccacgcgggt
                        **************************************************

A0A3Q1NFP6_PMAIP1-      cccggcagatcctgaagttgaatgtgccattcagttgaggagaattggag
A0A4W2CDL0_PMAIP1-      cccggcagatcctgaagttgaatgtgccattcagttgaggagaattggag
                        **************************************************

A0A3Q1NFP6_PMAIP1-      acaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctc
A0A4W2CDL0_PMAIP1-      acaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctc
                        **************************************************

A0A3Q1NFP6_PMAIP1-      cgctcaggaacttga
A0A4W2CDL0_PMAIP1-      cgctcaggaacttga
                        ***************

© 1998-2020Legal notice