Dataset for CDS HRK of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W2CRW4_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A4W2GVZ3_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc

A0A4W2CRW4_HRK-01      ctgcagcgccggccgcctgggtctgcgctcgtccgccgcgcagctcacgg
A0A4W2GVZ3_HRK-01      ctgcagcgccggccgcctgggtctgcgctcgtccgccgcgcagctcacgg

A0A4W2CRW4_HRK-01      cagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtgg
A0A4W2GVZ3_HRK-01      cagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtgg

A0A4W2CRW4_HRK-01      cggcgccgcgcgcggagccggagggcgccggcgtccggcgcgctccctac
A0A4W2GVZ3_HRK-01      cggcgccgcgcgcggagccggagggcgccggcgcccggcgcgctccctac
                       ********************************* ****************

A0A4W2CRW4_HRK-01      ctactggccctggctgtgcgcggccgcgcaggtggcagcgctggcggcct
A0A4W2GVZ3_HRK-01      ctactggccctggctgtgcgcggccgcgcaggtggcagcgctggcggcct

A0A4W2CRW4_HRK-01      ggctgctcggcaggcggaacttgtag
A0A4W2GVZ3_HRK-01      ggctgctcggcaggcggaacttgtag

© 1998-2022Legal notice