Dataset for CDS BMF of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q05KI3_BMF-02      atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcccgaggatggg
Q05KI3_BMF-01      atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcccgaggatggg

Q05KI3_BMF-02      gagccggggacccagcccaggagcttgctctctgctgacctgtttgcccagagccagctg
Q05KI3_BMF-01      gagccggggacccagcccaggagcttgctctctgctgacctgtttgcccagagccagctg

Q05KI3_BMF-02      gactgccccctcagccgtctgcagctcttccctctcacgcactgctgtggccctgggctt
Q05KI3_BMF-01      gactgccccctcagccgtctgcagctcttccctctcacgcactgctgtggccctgggctt

Q05KI3_BMF-02      cgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
Q05KI3_BMF-01      cgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag

Q05KI3_BMF-02      ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggccatgct
Q05KI3_BMF-01      ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggccatgct

Q05KI3_BMF-02      ggctaccggctcccccttcctgccagtttccctgcaggcttgccccttggtgagcagccc
Q05KI3_BMF-01      ggctaccggctcccccttcctgccagtttccctgcaggcttgccccttggtgagcagccc

Q05KI3_BMF-02      cctgaagggcagtggcaacatcgagcagagatacagattgcccgaaaactccagtgcatt
Q05KI3_BMF-01      cctgaagggcagtggcaacatcgagcagagatacagattgcccgaaaactccagtgcatt

Q05KI3_BMF-02      gcagaccagttccatcggcttcatatgcagcaataccagcagaaccgaaatcgcatgtgg
Q05KI3_BMF-01      gcagaccagttccatcggcttcatatgcagcaataccagcagaaccgaaatcgcatgtgg

Q05KI3_BMF-02      tggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaacggg
Q05KI3_BMF-01      tggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaacggg

Q05KI3_BMF-02      gcaggccccaggtga
Q05KI3_BMF-01      gcaggccccaggtga

© 1998-2020Legal notice