Dataset for CDS classical BH3-containing proteins of organism Bos mutus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


L8IXF5_BMF-01          atgg---agccacc-------------ccagtgtgtggaggagctggagg
L8IVA4_BCL2L11-02      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
L8IVA4_BCL2L11-01      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
                       ****   *** ***              * * *****   ***  ** **

L8IXF5_BMF-01          atgacgtattccagcccgaggatggggagccggggacccagcccaggagc
L8IVA4_BCL2L11-02      aca----attgcagcctgccgagaggcctcctcag-ctcagaccgggggc
L8IVA4_BCL2L11-01      aca----attgcagcctgccgagaggcctcctcag-ctcagaccgggggc
                       *      *** ***** *  **  **   **   * * *** ** ** **

L8IXF5_BMF-01          ttgctctctgctgacctgtttgcccagagccagctgga------------
L8IVA4_BCL2L11-02      c---------cccacctcttta--cagacagagcggcaaggtaatcctga
L8IVA4_BCL2L11-01      c---------cccacctcttta--cagacagagcggca------------
                                 *  **** ***   ****   *** * *            

L8IXF5_BMF-01          ---------------ctgccccctcagccgtctgcagctcttcc---ctc
L8IVA4_BCL2L11-02      aggagaaggggaccgctgcccccaaggcagcccacagggcccgctggccc
L8IVA4_BCL2L11-01      --------------------------------------------------
                                                                         

L8IXF5_BMF-01          tcacgcactgctgtggccct------------------------------
L8IVA4_BCL2L11-02      caccggccagccctggccctttcgctaccagatccccgctcttcatcttc
L8IVA4_BCL2L11-01      --------------------------------------------------
                                                                         

L8IXF5_BMF-01          --------------------------------------------------
L8IVA4_BCL2L11-02      gtgagaagatcctccttgctgtctcgatcctccagtgggtatttctcttt
L8IVA4_BCL2L11-01      --------------------------------------------------
                                                                         

L8IXF5_BMF-01          ------gggcttcgacccaccagccaggaa----gacaaggctacccaga
L8IVA4_BCL2L11-02      tgacacagacaggagcccggcacccatgagttgtgacaaatccacacaga
L8IVA4_BCL2L11-01      ------agacaggagcccggcacccatgagttgtgacaaatccacacaga
                              * *     ***  ** *** **     *****  * ** ****

L8IXF5_BMF-01          ctctcagcccagcttccccgagccagggtgtcatgctgccttgtggggtg
L8IVA4_BCL2L11-02      ccccaagccctcctt------gccag-----------gcctt--------
L8IVA4_BCL2L11-01      ccccaagccctcctt------gccag-----------gcctt--------
                       * *  *****  ***      *****           *****        

L8IXF5_BMF-01          actgaggagccccagcgactcttttatggcaatgctggctacc----ggc
L8IVA4_BCL2L11-02      ------------caaccattatctcagtgcaa---tggcttccatgaggc
L8IVA4_BCL2L11-01      ------------caaccattatctcagtgcaa---tggcttccatgaggc
                                   ** * * * * * *  ****   ***** **    ***

L8IXF5_BMF-01          tcccccttcctgccagtttccctgcaggcttgccccttggtgagcaaccc
L8IVA4_BCL2L11-02      agtctcaggctg------tacctgcagatacacgcc--------------
L8IVA4_BCL2L11-01      agtctcaggctg------tacctgcagatacacgcc--------------
                          * *   ***      * *******     * **              

L8IXF5_BMF-01          cctgaagggcagtggcaacatcgagcagagatacagattgcccgaaaact
L8IVA4_BCL2L11-02      -------------------------cagagatatggattgcccaagagct
L8IVA4_BCL2L11-01      -------------------------cagagatatggattgcccaagagct
                                                ********  ******** * * **

L8IXF5_BMF-01          ccagtgcattgcagaccagttccat-----------------cggcttca
L8IVA4_BCL2L11-02      acggcgtatcggagacgagtttaatgcatattacccaagaagggtcttcg
L8IVA4_BCL2L11-01      acggcgtatcggagacgagtttaatgcatattacccaagaagggtcttcg
                        * * * ** * **** ****  **                  * **** 

L8IXF5_BMF-01          tatgcagcaataccagcagaaccgaaatcgcatgtggtggcagatcctcc
L8IVA4_BCL2L11-02      tgcgtcaccagg-cagttgagggccacccgcaaatgg-------tcctct
L8IVA4_BCL2L11-01      tgcgtcaccagg-cagttgagggccacccgcaaatgg-------tcctct
                       *  *   * *   ***  **     *  ****  ***       ***** 

L8IXF5_BMF-01          ------tcttcctacacaacgtg-gctttgaatggagatgagaacaggaa
L8IVA4_BCL2L11-02      tgcgcgtcttgcgctacatcgtgcgtctggtgtggag-------------
L8IVA4_BCL2L11-01      tgcgcgtcttgcgctacatcgtgcgtctggtgtggag-------------
                             **** *   *** **** *  * *  *****             

L8IXF5_BMF-01          cggggcaggccccaggtga
L8IVA4_BCL2L11-02      -gatgca--------gtga
L8IVA4_BCL2L11-01      -gatgca--------gtga
                        *  ***        ****

© 1998-2020Legal notice