Dataset for CDS classical BH3-containing proteins of organism Athene cunicularia

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A663MLZ1_BCL2L11      ------------------------------------------------gg
A0A663MPI8_BMF-01       atgttattgtcgtgtcttagctgtttcctcaaatgtccctttattgcagg
A0A663N909_PMAIP1-      -------------------------------------------ctgccgg

A0A663MLZ1_BCL2L11      -----------------gtcaca---------------------------
A0A663MPI8_BMF-01       agcaatggatcgccccagctacctggaagaggactattctagcctggatg
A0A663N909_PMAIP1-      -----------------gccacc---------------------------
                                         *  **                            

A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A663MPI8_BMF-01       ggctggacgatgacgtgtttcactctgatgactttggacttgcaggtcag
A0A663N909_PMAIP1-      --------------------------------------------------

A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A663MPI8_BMF-01       cctggtgaaatgactgcaactggcattttcacacagaaccagtcctacag
A0A663N909_PMAIP1-      ------------accacaa-------------------------------

A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A663MPI8_BMF-01       ctgccttctggggaggtttcaactattccccctcacacactgctgtggtc
A0A663N909_PMAIP1-      -----------------------------------------gcggcggtg

A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A663MPI8_BMF-01       ccggtatcaggcatcctgagcagcaggacaaggcaactcaaacactcagc
A0A663N909_PMAIP1-      cgggtggctgac--------------------------------------

A0A663MLZ1_BCL2L11      --------------------------------------------------
A0A663MPI8_BMF-01       ccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaaga
A0A663N909_PMAIP1-      --------------------------------------------------

A0A663MLZ1_BCL2L11      -------------------ggctgctcctttctcc---------------
A0A663MPI8_BMF-01       gccccggagactcttctatggcaatgctggttaccgtttacacgtccctc
A0A663N909_PMAIP1-      -------------------ggccgtgcttgtgccc---------------
                                           ***    *   *  **               

A0A663MLZ1_BCL2L11      -------------------tctaaa-------------------------
A0A663MPI8_BMF-01       cagttggctttgcgttggatccgcacctccaagaggagcctcgagaaggt
A0A663N909_PMAIP1-      -------------------tctgca-------------------------
                                           **   *                         

A0A663MLZ1_BCL2L11      ------gacgtacagcccgaaatctggattgcacaggagctgcggcgcat
A0A663MPI8_BMF-01       cagcgggaagcacgtgccgaggtgcagattgcacggaagttgcagtgcat
A0A663N909_PMAIP1-      gagcgggaggcg-gtggcggagtgc-----gccctgcagctgcgcaggat
                              ** *       **   *       ** * * ** ***   * **

A0A663MLZ1_BCL2L11      cggagacgagttcaatgcctcctat-------------------------
A0A663MPI8_BMF-01       tgccgaccagttccaccggctccacatacagaggcatcagcagaacagaa
A0A663N909_PMAIP1-      aggcgacaagtgggacc---------------------------------
                         *  *** ***   *                                   

A0A663MLZ1_BCL2L11      ------tgtccaagaagggtaactttcatctttttactttccatttcttt
A0A663MPI8_BMF-01       atcaagtgtggtggcag----ctttttctcttcctacacaacttggcctt
A0A663N909_PMAIP1-      ------tgcggcagaag----atcctgaacctcct-cacaa---------
                              **     * **        *   * *  * *             

A0A663MLZ1_BCL2L11      acatatggcttctaaaagggaaaagcttaatcatctctggaaactagttc
A0A663MPI8_BMF-01       aaatgcggaggcgaacaggaaccacactgggc------agag--------
A0A663N909_PMAIP1-      -------------------agctgttctgccc------ggaaac------
                                                   *   *       **         

A0A663MLZ1_BCL2L11      tgcggtga
A0A663MPI8_BMF-01       ----gtga
A0A663N909_PMAIP1-      ----gtga

© 1998-2021Legal notice