Dataset for CDS classical BH3-containing proteins of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

21 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       atgtctgaagttagacccctctccagtgacatcttgatggagaccctctt
A0A2K5CA89_BCL2L11      -------atggcaaagcaaccttcc-------------gatgtaagttct
A0A2K5CA89_BCL2L11      -------atggcaaagcaaccttcc-------------gatgtaagttct
A0A2K5CA89_BCL2L11      -------atggcaaagcaaccttcc-------------gatgtaagttct
A0A2K5CA89_BCL2L11      -------atggcaaagcaaccttcc-------------gatgtaagttct
A0A2K5CA89_BCL2L11      -------atggcaaagcaaccttcc-------------gatgtaagttct
A0A2K5CA89_BCL2L11      -------atggcaaagcaaccttcc-------------gatgtaagttct
A0A2K5CA89_BCL2L11      -------atggcaaagcaaccttcc-------------gatgtaagttct
A0A2K5CA89_BCL2L11      -------atggcaaagcaaccttcc-------------gatgtaagttct
A0A2K5CA89_BCL2L11      -------atggcaaagcaaccttcc-------------gatgtaagttct
A0A2K5CA89_BCL2L11      -------atggcaaagcaaccttcc-------------gatgtaagttct
A0A2K5E1Q4_BMF-01       ----------atggagccatctcag-------------tgtgt-------
A0A2K5E1Q4_BMF-02       ----------atggagccatctcag-------------tgtgt-------
A0A2K5E6A6_BAD-03       -----------atgttccagatccc-------------agagtttgagcc
A0A2K5E6A6_BAD-02       -----------atgttccagatccc-------------agagtttgagcc
A0A2K5E6A6_BAD-01       -----------atgttccagatccc-------------agagtttgagcc
A0A2K5BYA0_HRK-01       ------------------------a-------------tgtgcccgtgcc
A0A2K5F6X4_BBC3-02      aaatgtggcgtggggtctgcctggg-------------catgtccatgcc
A0A2K5F6X4_BBC3-01      aaatgtggcgtggggtctgcctggg-------------catgtccatgcc
A0A2K5F6X4_BBC3-03      ---------------tctgcctggg-------------catgtccatgcc
                                                                          

A0A2K5CFK7_PMAIP1-      ----------------------------------------------atgc
A0A2K5CLG5_BIK-01       gtgtgagcagtt------------cgtgcatcccctgaccatggaggttg
A0A2K5CA89_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA89_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA89_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA89_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA89_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA89_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA89_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA89_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA89_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA89_BCL2L11      gagtg------------------------------------------tga
A0A2K5E1Q4_BMF-01       ggaggagctgga---------ggatgatgtgttccagtcag---------
A0A2K5E1Q4_BMF-02       ggaggagctgga---------ggatgatgtgttccagtcag---------
A0A2K5E6A6_BAD-03       gagtgagcagga----------------agactccagct--------ctg
A0A2K5E6A6_BAD-02       gagtgagcagga----------------agactccagct--------ctg
A0A2K5E6A6_BAD-01       gagtgagcagga----------------agactccagct--------ctg
A0A2K5BYA0_HRK-01       ccctgcaccgcg----------gtcgcggccccccggccgtttgcgcctg
A0A2K5F6X4_BBC3-02      aagtgcctagggcttcttcctcgacgtgggtcccctgccagatgtg-tgg
A0A2K5F6X4_BBC3-01      aagtgcctagggcttcttcctcgacgtgggtcccctgccagatgtg-t--
A0A2K5F6X4_BBC3-03      aagtgcctagggcttcttcctcgacgtgggtcccctgccagatgtg-tgg
                                                                          

A0A2K5CFK7_PMAIP1-      ctgggaagaaggcg---------------------------------cgc
A0A2K5CLG5_BIK-01       tcggtgggagtgaccctgaagaggacctggacc--------------ctg
A0A2K5CA89_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA89_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA89_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA89_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA89_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA89_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA89_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA89_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA89_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA89_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5E1Q4_BMF-01       -aggatggggagcc-------agggacccaacccgggagcttgctctctg
A0A2K5E1Q4_BMF-02       -aggatggggagcc-------agggacccaacccgggagcttgctctctg
A0A2K5E6A6_BAD-03       cagagaggg--gcc-------tgagccccagcaccg-----------cag
A0A2K5E6A6_BAD-02       cagagaggg--gcc-------tgagccccagcaccg-----------cag
A0A2K5E6A6_BAD-01       cagagaggg--gcc-------tgagccccagcaccg-----------cag
A0A2K5BYA0_HRK-01       cagcgcgggtcgcc-------tggggctgcgctcgt-----------ccg
A0A2K5F6X4_BBC3-02      tcc---------tc-------agccctcgctctcgc-----------tgg
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ccccagggagcgcc-------atggcccgcgcacgc-----------cag
                                                                          

A0A2K5CFK7_PMAIP1-      aagagcgcgcaaccga----------------------------------
A0A2K5CLG5_BIK-01       tggaggaccctttggaatgcatggagaacagtgac---------------
A0A2K5CA89_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA89_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA89_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA89_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA89_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA89_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA89_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA89_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA89_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA89_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5E1Q4_BMF-01       ctgacctgtttgcccagagcctactggactgc------------------
A0A2K5E1Q4_BMF-02       ctgacctgtttgcccagagcctactggactgc------------------
A0A2K5E6A6_BAD-03       gggacaggcc--cccaggctctggcaagc---------------------
A0A2K5E6A6_BAD-02       gggacaggcc--cccaggctctggcaagc---------------------
A0A2K5E6A6_BAD-01       gggacaggcc--cccaggctctggcaagc---------------------
A0A2K5BYA0_HRK-01       ccgcgcagct--c-------------------------------------
A0A2K5F6X4_BBC3-02      cggagcagca--cctggagtc-----------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      gagggcagct--ccccggagcccgtagagggcctggcccgcgacggcccg
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      cgccccttcccgctgccgcctgcgatgtttcccctcccgccgccacccgc
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      cgcaccgccgcctggccccgtggcctgggtgggtccccgcagccgccccc
                                                                          

A0A2K5CFK7_PMAIP1-      ---gcccctcgcggg-----------------------------------
A0A2K5CLG5_BIK-01       ---gcactggtcctg-----------------------------------
A0A2K5CA89_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA89_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA89_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA89_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA89_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA89_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA89_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA89_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA89_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA89_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5E1Q4_BMF-01       ---cccctcagccgg-----------------------------------
A0A2K5E1Q4_BMF-02       ---cccctcagccgg-----------------------------------
A0A2K5E6A6_BAD-03       ---atccacgccagg-----------------------------------
A0A2K5E6A6_BAD-02       ---atccacgccagg-----------------------------------
A0A2K5E6A6_BAD-01       ---atccacgccagg-----------------------------------
A0A2K5BYA0_HRK-01       ---accgccgcccgg-----------------------------------
A0A2K5F6X4_BBC3-02      ---gcccgtgcccag----------------------------------c
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      gaggcccgcgcccggacgagagggcccggaggctcggaggaactggagac
                                                                          

A0A2K5CFK7_PMAIP1-      -------------------------------------ctccagcagacct
A0A2K5CLG5_BIK-01       ----------------------------------------cagctggcct
A0A2K5CA89_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA89_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA89_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA89_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA89_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA89_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA89_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA89_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA89_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA89_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5E1Q4_BMF-01       -------------------------------------cttcagctcttcc
A0A2K5E1Q4_BMF-02       -------------------------------------cttcagctcttcc
A0A2K5E6A6_BAD-03       -------------------------------------ccccaggcctccc
A0A2K5E6A6_BAD-02       -------------------------------------ccccaggcctccc
A0A2K5E6A6_BAD-01       -------------------------------------ccccaggcctccc
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      gccccgggggccctggcgggcggtcccacccaggcggccccgggagtccg
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      gccccgggggccctggcgggcggtcccacccaggcggccccgggagtccg
                                                                          

A0A2K5CFK7_PMAIP1-      tgaagtcgagtgt-------------------------------------
A0A2K5CLG5_BIK-01       gcatcgcggaccaga---------tggatgtgagccttagggcccggagg
A0A2K5CA89_BCL2L11      acagacagagccaca-----------------------------------
A0A2K5CA89_BCL2L11      acagacagagccaca-----------------------------------
A0A2K5CA89_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5CA89_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5CA89_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5CA89_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5CA89_BCL2L11      acagacagagccaca-----------------------------------
A0A2K5CA89_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5CA89_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5CA89_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5E1Q4_BMF-01       ctctcacccactgct--------------gtggccctggccttcgaccca
A0A2K5E1Q4_BMF-02       ctctcacccactgct--------------gtggccctggccttcgaccca
A0A2K5E6A6_BAD-03       aggggacgc----ca--------------gtcaccagcagggacagccaa
A0A2K5E6A6_BAD-02       aggggacgc----ca--------------gtcaccagcagggacagccaa
A0A2K5E6A6_BAD-01       aggggacgc----ca--------------gtcaccagcagggacagccaa
A0A2K5BYA0_HRK-01       ---------------------------------ctcaaggcgctcggcga
A0A2K5F6X4_BBC3-02      cggggaggaggagca--------------gtgggcccgggagatcggggc
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      cggggaggaggagca--------------gtgggcccgggagatcggggc
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       ctggcc--------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5CA89_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5CA89_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5CA89_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5CA89_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5CA89_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5E1Q4_BMF-01       ccagcc--------------------------------------------
A0A2K5E1Q4_BMF-02       ccagcc--------------------------------------------
A0A2K5E6A6_BAD-03       ccagcagcagccaccatggaggtgagtactccacttgtgcctctgcttcc
A0A2K5E6A6_BAD-02       ccagcagcagccaccatgg-------------------------------
A0A2K5E6A6_BAD-01       ccagcagcagccaccatggaggcgc-------------------------
A0A2K5BYA0_HRK-01       cgagctgc------------------------------------------
A0A2K5F6X4_BBC3-02      ccagctgcggc---------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ccagctgcggc---------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5CA89_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5CA89_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5CA89_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5CA89_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5CA89_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       tcatctgagaatcccagtgcaaggatgctctcgaaagcatcagcagggat
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5CA89_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5CA89_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5CA89_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5CA89_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5CA89_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       gtccgccccagccactgactcagaaaatgtaaagctggaggtgccttgct
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5E6A6_BAD-01       -----------------------------tggggctgtggagacc---cg
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      ------------------------------------------------gg
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ------------------------------------------------gg
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       ---------------------------------------cagctctatga
A0A2K5CA89_BCL2L11      ------------------------------------agaca---------
A0A2K5CA89_BCL2L11      ------------------------------------agaca---------
A0A2K5CA89_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5CA89_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5CA89_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5CA89_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5CA89_BCL2L11      ------------------------------------agaca---------
A0A2K5CA89_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5CA89_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5CA89_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5E1Q4_BMF-01       --------------------------------aggaagacaag-------
A0A2K5E1Q4_BMF-02       --------------------------------aggaagacaag-------
A0A2K5E6A6_BAD-03       gggtcgccacagctcctaccccgcagggacggaggaggacgaagggatgg
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5E6A6_BAD-01       aagtcgccacagctcctaccccgcagggacggaggaggacgaagggatgg
A0A2K5BYA0_HRK-01       --------------------------------------accagcgcacca
A0A2K5F6X4_BBC3-02      atggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagca
A0A2K5F6X4_BBC3-01      -----------------------------------gagacaagaggagca
A0A2K5F6X4_BBC3-03      atggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagca
                                                                          

A0A2K5CFK7_PMAIP1-      ----gccactcaactcaggagatttggagacaaactaaatttccggc---
A0A2K5CLG5_BIK-01       ggtggccatgtacagcccgggtctcgctttcatcctcga---ccggaccg
A0A2K5CA89_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaa---tcaacaca
A0A2K5CA89_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaa---tcaacaca
A0A2K5CA89_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaa---tcaacaca
A0A2K5CA89_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaa---tcaacaca
A0A2K5CA89_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaa---tcaacaca
A0A2K5CA89_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaa---tcaacaca
A0A2K5CA89_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaa---tcaacaca
A0A2K5CA89_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaa---tcaacaca
A0A2K5CA89_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaa---tcaacaca
A0A2K5CA89_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaa---tcaacaca
A0A2K5E1Q4_BMF-01       ----gctacccagaccctca-----------------gc---ccagcctc
A0A2K5E1Q4_BMF-02       ----gctacccagaccctca-----------------gc---ccagcctc
A0A2K5E6A6_BAD-03       aggaggagcccagcccct----ttcggggccgttcgcgc---tcagcacc
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5E6A6_BAD-01       aggaggagcccagcccct----ttcggggccgttcgcgc---tcagcacc
A0A2K5BYA0_HRK-01       tgtggcggcgccgcgcgcggagccggagggcgccagcgc---ccggcgcg
A0A2K5F6X4_BBC3-02      -gccgcagcaccgcccctcaccctggagg--------gt---cctgtaca
A0A2K5F6X4_BBC3-01      -gccgcagcaccgcccctcaccctggagg--------gt---cctgtaca
A0A2K5F6X4_BBC3-03      -gccgcagcaccgcccctcaccctggagg--------gt---cctgtaca
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       acatcggggatgttcttagcggtatcgtgg-----aagttttcgctaact
A0A2K5CA89_BCL2L11      aaccc---------------------------------------------
A0A2K5CA89_BCL2L11      aaccc---------------------------------------------
A0A2K5CA89_BCL2L11      aaccc---------------------------------------------
A0A2K5CA89_BCL2L11      aaccc---------------------------------------------
A0A2K5CA89_BCL2L11      aaccc---------------------------------------------
A0A2K5CA89_BCL2L11      aaccc---------------------------------------------
A0A2K5CA89_BCL2L11      aaccc---------------------------------------------
A0A2K5CA89_BCL2L11      aaccc---------------------------------------------
A0A2K5CA89_BCL2L11      aaccc---------------------------------------------
A0A2K5CA89_BCL2L11      aaccc---------------------------------------------
A0A2K5E1Q4_BMF-01       ccccagccaaggtgtcatgctgccttgtgg--------------------
A0A2K5E1Q4_BMF-02       ccccagccaaggtgtcatgctgccttgtgg--------------------
A0A2K5E6A6_BAD-03       ccccaacctctgggcagcacagcgctatggccgcgagctccggaggatga
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5E6A6_BAD-01       ccccaacctctgggcagcacagcgctatggccgcgagctccggaggatga
A0A2K5BYA0_HRK-01       ctccccac------------------------------------------
A0A2K5F6X4_BBC3-02      atctcatca-----------------------------------------
A0A2K5F6X4_BBC3-01      atctcatca-----------------------------------------
A0A2K5F6X4_BBC3-03      atctcatca-----------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      ------------------------agaaacttctgaatc-----------
A0A2K5CLG5_BIK-01       tccaggaggacatagtgaggctctggagatccctgagct-----------
A0A2K5CA89_BCL2L11      ------------------------caagtcctccttgcc-----------
A0A2K5CA89_BCL2L11      ------------------------caagtcctccttgcc-----------
A0A2K5CA89_BCL2L11      ------------------------caagtcctccttgcc-----------
A0A2K5CA89_BCL2L11      ------------------------caagtcctccttgcc-----------
A0A2K5CA89_BCL2L11      ------------------------caagtcctccttgcc-----------
A0A2K5CA89_BCL2L11      ------------------------caagtcctccttgcc-----------
A0A2K5CA89_BCL2L11      ------------------------caagtcctccttgcc-----------
A0A2K5CA89_BCL2L11      ------------------------caagtcctccttgcc-----------
A0A2K5CA89_BCL2L11      ------------------------caagtcctccttgcc-----------
A0A2K5CA89_BCL2L11      ------------------------caagtcctccttgcc-----------
A0A2K5E1Q4_BMF-01       -------ggtgactgaggaaccccagcgactcttttacggcaatgctggc
A0A2K5E1Q4_BMF-02       -------ggtgactgaggaaccccagcgactcttttacg-----------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-02       ------------------------agggacttcctcgcc-----------
A0A2K5E6A6_BAD-01       gtgacgagtttgtggactcctttaagggacttcctcgcc-----------
A0A2K5BYA0_HRK-01       -----------------------------ctactggccc-----------
A0A2K5F6X4_BBC3-02      ------------------------tgggactcctgccct-----------
A0A2K5F6X4_BBC3-01      ------------------------tgggactcctgccct-----------
A0A2K5F6X4_BBC3-03      ------------------------tgggactcctgccct-----------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5E1Q4_BMF-01       tatcggcttcctctccctgccagtttcccagcagtcttgccccttgggga
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5E1Q4_BMF-01       gcagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       ------------------------------------------ccgggtcc
A0A2K5CA89_BCL2L11      ---------------------------------------------aggcc
A0A2K5CA89_BCL2L11      ---------------------------------------------aggcc
A0A2K5CA89_BCL2L11      ---------------------------------------------aggcc
A0A2K5CA89_BCL2L11      ---------------------------------------------aggcc
A0A2K5CA89_BCL2L11      ---------------------------------------------aggcc
A0A2K5CA89_BCL2L11      ---------------------------------------------aggcc
A0A2K5CA89_BCL2L11      ---------------------------------------------aggcc
A0A2K5CA89_BCL2L11      ---------------------------------------------aggcc
A0A2K5CA89_BCL2L11      ---------------------------------------------aggcc
A0A2K5CA89_BCL2L11      ---------------------------------------------aggcc
A0A2K5E1Q4_BMF-01       gaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaa
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-02       ----------------------------------------cgaagagcgc
A0A2K5E6A6_BAD-01       ----------------------------------------cgaagagcgc
A0A2K5BYA0_HRK-01       ----------------------------------------tggctgtgcg
A0A2K5F6X4_BBC3-02      ----------------------------------------ttcccagggg
A0A2K5F6X4_BBC3-01      ----------------------------------------ttcccagggg
A0A2K5F6X4_BBC3-03      ----------------------------------------ttcccagggg
                                                                          

A0A2K5CFK7_PMAIP1-      ------------------------------------------tgatatcc
A0A2K5CLG5_BIK-01       tgggtgtcccgcaaacaggcagt-------------gctgctggcactcc
A0A2K5CA89_BCL2L11      ttcaaccactatctcagtgcaat------------gggtgatat---ttc
A0A2K5CA89_BCL2L11      ttcaaccactatctcagtgcaat------------ggatgaggccactga
A0A2K5CA89_BCL2L11      ttcaaccactatctcagtgcaat------------ggtt-----------
A0A2K5CA89_BCL2L11      ttcaaccactatctcagtgcaat---------------------------
A0A2K5CA89_BCL2L11      ttcaaccactatctcagtgcaat------------ggcttccatgaggca
A0A2K5CA89_BCL2L11      ttcaaccactatctcagtgcaat------------ggcttccatgaggca
A0A2K5CA89_BCL2L11      ttcaaccactatctcagtgcaat------------ggcttccatgaggca
A0A2K5CA89_BCL2L11      ttcaaccactatctcagtgcaat------------ggcttccatgaggca
A0A2K5CA89_BCL2L11      ttcaaccactatctcagtgcaat------------ggcttccatgaggca
A0A2K5CA89_BCL2L11      ttcaaccactatctcagtgcaat------------ggct-----------
A0A2K5E1Q4_BMF-01       catcagcagaaccgaaatcgcgt----------gtggtggcaggtcctcc
A0A2K5E1Q4_BMF-02       catcagcagaaccgaaatcgcgt----------gtggtggcaggtcctcc
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-02       gggcacagcaacgcagatgcggcaaagctccagttggacgcaagtcatcc
A0A2K5E6A6_BAD-01       gggcacagcaacgcagatgcggcaaagctccagttggacgcaagtcatcc
A0A2K5BYA0_HRK-01       cggccgcgc-----aggtggcgg------c--gctggcggcctg------
A0A2K5F6X4_BBC3-02      ccacagagcccccgagatggagc------ccaattag-------------
A0A2K5F6X4_BBC3-01      ccacagagcccccgagatggagc------ccaattaggtgcctgcacccg
A0A2K5F6X4_BBC3-03      ccacagagcccccgagatggagc------ccaattaggtgcctgcacccg
                                                                          

A0A2K5CFK7_PMAIP1-      aaactcttctgctcaggaacctga--------------------------
A0A2K5CLG5_BIK-01       tggcgctgctg-------------------------------------ct
A0A2K5CA89_BCL2L11      attgtggtttagatttatatttaccttctttgatttgtatggccaccacc
A0A2K5CA89_BCL2L11      atcctcccttggaattgc---ccttcgtaggga--ggttcagtggccact
A0A2K5CA89_BCL2L11      ------------------------------aga--gaaataga------g
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      atctcaggctgaacctgcaggtatgcgcccgga--gatatggatcgccca
A0A2K5CA89_BCL2L11      atctcaggctgaacctgcaggtatgcgcccgga--gatatggatcgccca
A0A2K5CA89_BCL2L11      atctcaggctgaacctgcaggtatgcgcccgga--gatatggatcgccca
A0A2K5CA89_BCL2L11      atctcaggctgaacctgcaggtatgcgcccgga--gatatggatcgccca
A0A2K5CA89_BCL2L11      atctcaggctgaacctgcaggtatgcgcccgga--gatatggatcgccca
A0A2K5CA89_BCL2L11      ------gact----------------------------------------
A0A2K5E1Q4_BMF-01       tctttctgcacaacctggctttgaatggagaa------------------
A0A2K5E1Q4_BMF-02       tctttctgcacaacctggctttgaatggagaa------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-02       agtcctggtgggatcggaacttg---------------------------
A0A2K5E6A6_BAD-01       agtcctggtgggatcggaacttg---------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      cccggtggacgtcagggactcggggggcaggcc--cctcccacctcctga
A0A2K5F6X4_BBC3-03      cccggtggacgtcagggactcggggggcaggcc--cctcccacctcctga
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       ggcgatgttcagcgggggtctgcacctgctgctcaagtga----------
A0A2K5CA89_BCL2L11      acagtcaaggtacag----aacaactccaccac--------------aag
A0A2K5CA89_BCL2L11      tgagtggt----tagcaaaatcaagctga---------------------
A0A2K5CA89_BCL2L11      gaagttgtcgtgtag-----------------------------------
A0A2K5CA89_BCL2L11      -----------------------------------------------ggg
A0A2K5CA89_BCL2L11      agagttgcggcgtatcggagacgagtttaacgcttattatccaaggaggg
A0A2K5CA89_BCL2L11      agagttgcggcgtatcggagacgagtttaacgcttattatccaaggaggg
A0A2K5CA89_BCL2L11      agagttgcggcgtatcggagacgagtttaacgcttattatccaaggaggg
A0A2K5CA89_BCL2L11      agagttgcggcgtatcggagacgagtttaacgcttattatccaaggagga
A0A2K5CA89_BCL2L11      agagttgcggcgtatcggagacgagtttaacgcttattatccaaggaggt
A0A2K5CA89_BCL2L11      -----------------gggactag-------------------------
A0A2K5E1Q4_BMF-01       ----------gagaacaggaatggggcaggcccgaggtga----------
A0A2K5E1Q4_BMF-02       ----------gagaacaggaatggggcaggcccgag--------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-02       ----------ggcaggggaggctccgctccctcccagtgaccttcgctcc
A0A2K5E6A6_BAD-01       ----------ggcaggggaggctccgctccctcccagtga----------
A0A2K5BYA0_HRK-01       ---gctgctcggcaggcggaact------------tgtag----------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      caccctggccagcgcgggggactttctctgcaccatgtag----------
A0A2K5F6X4_BBC3-03      caccctggccagcgcgggggactttctctgcaccatgtag----------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA89_BCL2L11      tatttctcatga--------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      tattttt-------gaataa------------------------------
A0A2K5CA89_BCL2L11      tattttt-------gaataattaccaagcagccgaagaccacccacacat
A0A2K5CA89_BCL2L11      tattttt-------gaataattaccaagcagccgaagaccacccacacat
A0A2K5CA89_BCL2L11      tattttt-------gaataattaccaagcagccgaagaccacccacacat
A0A2K5CA89_BCL2L11      tatctcttccatctgattga------------------------------
A0A2K5CA89_BCL2L11      ta------------gagaaatag---------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-02       acatcccgaaactccacccgttcccatcgccttgggcggccatcttggat
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      ggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgc
A0A2K5CA89_BCL2L11      ggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgc
A0A2K5CA89_BCL2L11      ggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgc
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-02       atgggcggaagtgcttcctgcagggagagctgacccagattcccttccgg
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      ---------
A0A2K5CLG5_BIK-01       ---------
A0A2K5CA89_BCL2L11      ---------
A0A2K5CA89_BCL2L11      ---------
A0A2K5CA89_BCL2L11      ---------
A0A2K5CA89_BCL2L11      ---------
A0A2K5CA89_BCL2L11      attga----
A0A2K5CA89_BCL2L11      attga----
A0A2K5CA89_BCL2L11      attga----
A0A2K5CA89_BCL2L11      ---------
A0A2K5CA89_BCL2L11      ---------
A0A2K5CA89_BCL2L11      ---------
A0A2K5E1Q4_BMF-01       ---------
A0A2K5E1Q4_BMF-02       ---------
A0A2K5E6A6_BAD-03       ---------
A0A2K5E6A6_BAD-02       tgcgtgtga
A0A2K5E6A6_BAD-01       ---------
A0A2K5BYA0_HRK-01       ---------
A0A2K5F6X4_BBC3-02      ---------
A0A2K5F6X4_BBC3-01      ---------
A0A2K5F6X4_BBC3-03      ---------
                                 

© 1998-2020Legal notice