Dataset for CDS classical BH3-containing proteins of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5CLG5_BIK-01       --------------------atgtctgaagttagacccctctccagtg--
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------atggcaaagcaaccttccgatgta
A0A2K5CA89_BCL2L11      --------------------------atggcaaagcaaccttccgatgta
A0A2K5E1Q4_BMF-02       ------------------------atggagcc-atc------tcagtgtg
A0A2K5E1Q4_BMF-01       ------------------------atggagcc-atc------tcagtgtg
A0A2K5E6A6_BAD-03       ------------------------atgttccagatc------ccagagtt
A0A2K5E6A6_BAD-01       ------------------------atgttccagatc------ccagagtt
A0A2K5BYA0_HRK-01       ------------------------atgtgcccgtgc------cccctgca
A0A2K5F6X4_BBC3-02      aaatgtggcgtggggtctgcctgggcatgtccatgc------caagtgcc
                                                                          

A0A2K5CLG5_BIK-01       ------acatcttgatggagaccctcttgtgtgagcagttcgtgcatccc
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CA89_BCL2L11      agttctgagtgtgaccgagaaggtaga-----------------------
A0A2K5CA89_BCL2L11      agttctgagtgtgaccgagaaggtaga-----------------------
A0A2K5E1Q4_BMF-02       tg----gag-gagctggaggatgatgtgttccagtcagaggatggggagc
A0A2K5E1Q4_BMF-01       tg----gag-gagctggaggatgatgtgttccagtcagaggatggggagc
A0A2K5E6A6_BAD-03       tgagccgagtgagcaggaaga-------ctccagctctgcagagaggggc
A0A2K5E6A6_BAD-01       tgagccgagtgagcaggaaga-------ctccagctctgcagagaggggc
A0A2K5BYA0_HRK-01       cc----gcg----------gtcgcggccccccggc---------------
A0A2K5F6X4_BBC3-02      ta----gggcttcttcctcgacgtgggtcccctgccagat-gtgtggtcc
                                                                          

A0A2K5CLG5_BIK-01       ctgaccatggaggttgtcggtgggagtgac--cctgaagaggacctggac
A0A2K5CFK7_PMAIP1-      -------------atgcctgggaagaaggc--------------------
A0A2K5CA89_BCL2L11      -------caattgcagcctgcggagagacctccccagctcagacctg---
A0A2K5CA89_BCL2L11      -------caattgcagcctgcggagagacctccccagctcagacctg---
A0A2K5E1Q4_BMF-02       cagggacccaac----ccgg--gagcttgctctctg---ctgacctgttt
A0A2K5E1Q4_BMF-01       cagggacccaac----ccgg--gagcttgctctctg---ctgacctgttt
A0A2K5E6A6_BAD-03       ctgagccccagcaccgcagg--ggacaggcccccaggctctggcaagcat
A0A2K5E6A6_BAD-01       ctgagccccagcaccgcagg--ggacaggcccccaggctctggcaagcat
A0A2K5BYA0_HRK-01       --------cgtttgcgcctgcagcgcgggtcgcctggggctgcgctc---
A0A2K5F6X4_BBC3-02      tcagccctcgctctcgctggcggagcag--cacctggagtcgcccgt---
                                           *                              

A0A2K5CLG5_BIK-01       cctgtggaggaccctttggaatgcatggagaacagtgacgcactggtcct
A0A2K5CFK7_PMAIP1-      ---------gcgca---agagcgcgcaaccgagcccctc-----------
A0A2K5CA89_BCL2L11      --------gggccc---ctacctccctacagac-----------agagcc
A0A2K5CA89_BCL2L11      --------gggccc---ctacctccctacagac-----------agagcc
A0A2K5E1Q4_BMF-02       ---------gccca---gagcctactggactgccccctcagccggc---t
A0A2K5E1Q4_BMF-01       ---------gccca---gagcctactggactgccccctcagccggc---t
A0A2K5E6A6_BAD-03       ccacgccaggcccc---aggcctcccaggggacgccagtcaccagcaggg
A0A2K5E6A6_BAD-01       ccacgccaggcccc---aggcctcccaggggacgccagtcaccagcaggg
A0A2K5BYA0_HRK-01       ---------gtcc------gccgcgcag----------------------
A0A2K5F6X4_BBC3-02      ---------gccc------agcgccccgggggccctggcgggcggt----
                                 *  *                                     

A0A2K5CLG5_BIK-01       gcagctggcctgcatcgcggaccagatggatgtgagccttagggcccgga
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CA89_BCL2L11      aca-----------------------------------------------
A0A2K5CA89_BCL2L11      acaaggtaatcccgaaggcaatca---------------cggaggtgaag
A0A2K5E1Q4_BMF-02       tcagctcttccctctcacccactg---------------ctgtggc----
A0A2K5E1Q4_BMF-01       tcagctcttccctctcacccactg---------------ctgtggc----
A0A2K5E6A6_BAD-03       acagccaaccagcagcagccacca---------------tggaggtgagt
A0A2K5E6A6_BAD-01       acagccaaccagcagcagccacca---------------tggaggcg---
A0A2K5BYA0_HRK-01       -----------------ctcacc------------------gccgc----
A0A2K5F6X4_BBC3-02      -----------------cccaccc---------------aggcggc----
                                                                          

A0A2K5CLG5_BIK-01       ggctggcccagctctatgaggtggccatgtacagcccgggtctcgctttc
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      gggacagctgcccccacggcagccctcagggcccgctggccccaccggcc
A0A2K5E1Q4_BMF-02       -------cctggccttcgacccaccagccaggaagacaaggcta------
A0A2K5E1Q4_BMF-01       -------cctggccttcgacccaccagccaggaagacaaggcta------
A0A2K5E6A6_BAD-03       actccacttgtgcctctgcttcctcatctgagaatcccagtgcaaggatg
A0A2K5E6A6_BAD-01       -------ctggggctgtg-----------gaga-----------------
A0A2K5BYA0_HRK-01       ------------cc---------------------------ggc------
A0A2K5F6X4_BBC3-02      ------------cccgggagtccgcggggaggaggagcagtggg------
                                                                          

A0A2K5CLG5_BIK-01       atcctcgaccg---------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      agccctggcccttttgctaccagatccccgcttttcatctttgtgagaag
A0A2K5E1Q4_BMF-02       --cccagaccc---------------------------------------
A0A2K5E1Q4_BMF-01       --cccagaccc---------------------------------------
A0A2K5E6A6_BAD-03       ctctcgaaagcatcagcagggatgtccgccccagccactgactcagaaaa
A0A2K5E6A6_BAD-01       --cccgaa------------------------------------------
A0A2K5BYA0_HRK-01       --tcaaggcgc---------------------------------------
A0A2K5F6X4_BBC3-02      --cccgggaga---------------------------------------
                                                                          

A0A2K5CLG5_BIK-01       -------------------------------------------gaccgac
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CA89_BCL2L11      ------------------------------------------------ag
A0A2K5CA89_BCL2L11      atcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacag
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       tgtaaagctggaggtgccttgct-------------------------gg
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
                                                                          

A0A2K5CLG5_BIK-01       atcggggatgttcttagcggtatcgtggaagttttcgctaacttccagga
A0A2K5CFK7_PMAIP1-      -gcgggctccagcagacct-------------------------------
A0A2K5CA89_BCL2L11      acaggagcccagcacccat---------gagttgtgacaa------atca
A0A2K5CA89_BCL2L11      acaggagcccagcacccat---------gagttgtgacaa------atca
A0A2K5E1Q4_BMF-02       -tca--gcccagcctcccc----cagccaaggtgtcatgc------tgcc
A0A2K5E1Q4_BMF-01       -tca--gcccagcctcccc----cagccaaggtgtcatgc------tgcc
A0A2K5E6A6_BAD-03       gtcg--ccacagctcctac----cccgcaggg----acgg------agga
A0A2K5E6A6_BAD-01       gtcg--ccacagctcctac----cccgcaggg----acgg------agga
A0A2K5BYA0_HRK-01       -tcggcgacgagctgcacc----agcgcaccatgtggcgg------cgcc
A0A2K5F6X4_BBC3-02      -tcggggcccagctgcggcggatggcggacgacctcaacg------cgca
                                    *                                     

A0A2K5CLG5_BIK-01       ggacatagtgaggctctggagat------------------ccctgagct
A0A2K5CFK7_PMAIP1-      ----------tgaagtcgagtgt----------------gccactcaac-
A0A2K5CA89_BCL2L11      acac--------aaaccccaagt-----cctccttgccaggccttcaacc
A0A2K5CA89_BCL2L11      acac--------aaaccccaagt-----cctccttgccaggccttcaacc
A0A2K5E1Q4_BMF-02       ttgt-----ggggtgactgagga------------------accccagcg
A0A2K5E1Q4_BMF-01       ttgt-----ggggtgactgagga------------------accccagcg
A0A2K5E6A6_BAD-03       ggac-----gaagggatggagga----------------ggagcccagc-
A0A2K5E6A6_BAD-01       ggac-----gaagggatggagga----------------ggagcccagc-
A0A2K5BYA0_HRK-01       gcgc-----gcggagccggagggcgccagcgcccggcgcgctccccacct
A0A2K5F6X4_BBC3-02      gtacgagcggcggagacaagagg----agcagccgcagcaccgccc----
                                                                          

A0A2K5CLG5_BIK-01       ccgggtcctgggtgtcccg---caaacaggcagtgctgctggcactcctg
A0A2K5CFK7_PMAIP1-      ------tcaggagatttggagacaaactaaatttccggcagaaacttctg
A0A2K5CA89_BCL2L11      actatctcagtgcaatgggtgatat---ttcattgtggtttagatttata
A0A2K5CA89_BCL2L11      actatctcagtgcaatggcttccatgaggcaatctcaggctgaacctgca
A0A2K5E1Q4_BMF-02       actcttttacg---------------------------------------
A0A2K5E1Q4_BMF-01       actcttttacggcaatgctggctat-------cggcttcctctccctgcc
A0A2K5E6A6_BAD-03       -ccctttcggg---------gccgt-------tcgcgctcagcacccccc
A0A2K5E6A6_BAD-01       -ccctttcggg---------gccgt-------tcgcgctcagcacccccc
A0A2K5BYA0_HRK-01       actggccctggctgtgcgcggccgc-------gcaggtggcggcgctggc
A0A2K5F6X4_BBC3-02      -ctcaccctggagggtcctgtacaa-------tctcatcatgggactcct
                                                                          

A0A2K5CLG5_BIK-01       gcgctgctgctggcgatgttcagcg-------------------------
A0A2K5CFK7_PMAIP1-      aatct--------gatatccaaactcttctg-------------------
A0A2K5CA89_BCL2L11      --tttaccttctttgatttgtatggccacca-------------------
A0A2K5CA89_BCL2L11      ggtatgcgcccggagatatggatcgcc-----------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       agtttccc-----agcagtcttgccccttggggagcagccccccgaaggg
A0A2K5E6A6_BAD-03       aacctctg-----ggcagcacagcgctatgg-------------------
A0A2K5E6A6_BAD-01       aacctctg-----ggcagcacagcgctatgg-------------------
A0A2K5BYA0_HRK-01       ggcct--------ggctgctcggc-----ag-------------------
A0A2K5F6X4_BBC3-02      gccctttcccaggggccacagagcccccgag-------------------
                                                                          

A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CA89_BCL2L11      ---------------------------------ccacagtcaaggtaca-
A0A2K5CA89_BCL2L11      ---------------------------------caagagttgcggcgtat
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       cagtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcat
A0A2K5E6A6_BAD-03       --------------------------------ccgcgagctccggaggat
A0A2K5E6A6_BAD-01       --------------------------------ccgcgagctccggaggat
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
                                                                          

A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CA89_BCL2L11      ---gaacaactcc-------------------------------------
A0A2K5CA89_BCL2L11      cggagacgagttt-------------------------------------
A0A2K5E1Q4_BMF-02       ----------------------------------catcagcagaa-----
A0A2K5E1Q4_BMF-01       tgcagaccagttccaccggcttcatgtgcagcaacatcagcagaa-----
A0A2K5E6A6_BAD-03       ga------------------------------------------------
A0A2K5E6A6_BAD-01       gagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
                                                                          

A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CA89_BCL2L11      -------------------------------------accac--------
A0A2K5CA89_BCL2L11      -------------------------------------aacgcttattatc
A0A2K5E1Q4_BMF-02       ----------------------ccgaaatcgcgtgtggtggcaggtcctc
A0A2K5E1Q4_BMF-01       ----------------------ccgaaatcgcgtgtggtggcaggtcctc
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       cgggcacagcaacgcagatgcggcaaagctccagttggacgcaagtcatc
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
                                                                          

A0A2K5CLG5_BIK-01       ---ggggtctgcacctgctgctcaagtga---------------------
A0A2K5CFK7_PMAIP1-      ------------ctcaggaacctga-------------------------
A0A2K5CA89_BCL2L11      ----aagtatttctc----------atga---------------------
A0A2K5CA89_BCL2L11      caaggaggatatctcttccatctgattga---------------------
A0A2K5E1Q4_BMF-02       ctctttctgcacaacctggctttgaatggagaagagaacaggaatggggc
A0A2K5E1Q4_BMF-01       ctctttctgcacaacctggctttgaatggagaagagaacaggaatggggc
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       cagtcctggtgggatcggaacttgggcaggggaggctcc---------gc
A0A2K5BYA0_HRK-01       --------------gcggaacttg--tag---------------------
A0A2K5F6X4_BBC3-02      --------------atggagcccaattag---------------------
                                                                          

A0A2K5CLG5_BIK-01       -------------
A0A2K5CFK7_PMAIP1-      -------------
A0A2K5CA89_BCL2L11      -------------
A0A2K5CA89_BCL2L11      -------------
A0A2K5E1Q4_BMF-02       aggcccgag----
A0A2K5E1Q4_BMF-01       aggcccgaggtga
A0A2K5E6A6_BAD-03       -------------
A0A2K5E6A6_BAD-01       tccctcccagtga
A0A2K5BYA0_HRK-01       -------------
A0A2K5F6X4_BBC3-02      -------------
                                     

© 1998-2020Legal notice