Dataset for CDS classical BH3-containing proteins of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

21 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5CFK7_PMAIP1-      ---------------------------------------atgcctgggaa
A0A2K5CLG5_BIK-01       atgtctgaagttagacccctctccagtgacatcttgatggagaccctctt
A0A2K5CA52_BCL2L11      -------atggcaaagcaaccttccg-------------atgtaagttct
A0A2K5CA52_BCL2L11      -------atggcaaagcaaccttccg-------------atgtaagttct
A0A2K5CA52_BCL2L11      -------atggcaaagcaaccttccg-------------atgtaagttct
A0A2K5CA52_BCL2L11      -------atggcaaagcaaccttccg-------------atgtaagttct
A0A2K5CA52_BCL2L11      -------atggcaaagcaaccttccg-------------atgtaagttct
A0A2K5CA52_BCL2L11      -------atggcaaagcaaccttccg-------------atgtaagttct
A0A2K5CA52_BCL2L11      -------atggcaaagcaaccttccg-------------atgtaagttct
A0A2K5CA52_BCL2L11      -------atggcaaagcaaccttccg-------------atgtaagttct
A0A2K5CA52_BCL2L11      -------atggcaaagcaaccttccg-------------atgtaagttct
A0A2K5CA52_BCL2L11      -------atggcaaagcaaccttccg-------------atgtaagttct
A0A2K5E1Q4_BMF-01       ----------atggagccatctcagt-------------gtgt-------
A0A2K5E1Q4_BMF-02       ----------atggagccatctcagt-------------gtgt-------
A0A2K5E6A6_BAD-03       -----------atgttccagatccca-------------gagtttgagcc
A0A2K5E6A6_BAD-01       -----------atgttccagatccca-------------gagtttgagcc
A0A2K5E6A6_BAD-02       -----------atgttccagatccca-------------gagtttgagcc
A0A2K5BYA0_HRK-01       ------------------------at-------------gtgcccgtgcc
A0A2K5F6X4_BBC3-02      aaatgtggcgtggggtctgcctgggc-------------atgtccatgcc
A0A2K5F6X4_BBC3-01      aaatgtggcgtggggtctgcctgggc-------------atgtccatgcc
A0A2K5F6X4_BBC3-03      ---------------tctgcctgggc-------------atgtccatgcc
                                                                 *        

A0A2K5CFK7_PMAIP1-      gaaggcgcgcaa--------------------------------------
A0A2K5CLG5_BIK-01       gtgtgagcagtt------------cgtgcatcccctgaccatggaggttg
A0A2K5CA52_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA52_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA52_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA52_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA52_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA52_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA52_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA52_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA52_BCL2L11      gagtg------------------------------------------tga
A0A2K5CA52_BCL2L11      gagtg------------------------------------------tga
A0A2K5E1Q4_BMF-01       ggaggagctgga---------ggatgatgtgttccagtcag---------
A0A2K5E1Q4_BMF-02       ggaggagctgga---------ggatgatgtgttccagtcag---------
A0A2K5E6A6_BAD-03       gagtgagcagga----------------agactccagct--------ctg
A0A2K5E6A6_BAD-01       gagtgagcagga----------------agactccagct--------ctg
A0A2K5E6A6_BAD-02       gagtgagcagga----------------agactccagct--------ctg
A0A2K5BYA0_HRK-01       ccctgcaccgcg----------gtcgcggccccccggccgtttgcgcctg
A0A2K5F6X4_BBC3-02      aagtgcctagggcttcttcctcgacgtgggtcccctgccagatgtg-tgg
A0A2K5F6X4_BBC3-01      aagtgcctagggcttcttcctcgacgtgggtcccctgccagatgtg-t--
A0A2K5F6X4_BBC3-03      aagtgcctagggcttcttcctcgacgtgggtcccctgccagatgtg-tgg
                            *                                             

A0A2K5CFK7_PMAIP1-      --gagcgcgcaacc------------------------------------
A0A2K5CLG5_BIK-01       tcggtgggagtgaccctgaagaggacctggacc--------------ctg
A0A2K5CA52_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA52_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA52_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA52_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA52_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA52_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA52_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA52_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA52_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5CA52_BCL2L11      ccgagaaggtagac-------aattgcagc-----------------ctg
A0A2K5E1Q4_BMF-01       -aggatggggagcc-------agggacccaacccgggagcttgctctctg
A0A2K5E1Q4_BMF-02       -aggatggggagcc-------agggacccaacccgggagcttgctctctg
A0A2K5E6A6_BAD-03       cagagaggg--gcc-------tgagccccagcaccg-----------cag
A0A2K5E6A6_BAD-01       cagagaggg--gcc-------tgagccccagcaccg-----------cag
A0A2K5E6A6_BAD-02       cagagaggg--gcc-------tgagccccagcaccg-----------cag
A0A2K5BYA0_HRK-01       cagcgcgggtcgcc-------tggggctgcgctcgt-----------ccg
A0A2K5F6X4_BBC3-02      tcc---------tc-------agccctcgctctcgc-----------tgg
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ccccagggagcgcc-------atggcccgcgcacgc-----------cag
                                                                          

A0A2K5CFK7_PMAIP1-      ----gagcccctcgcgggctccagcagac---------------------
A0A2K5CLG5_BIK-01       tggaggaccctttggaatgcatggagaacagtgac---------------
A0A2K5CA52_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA52_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA52_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA52_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA52_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA52_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA52_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA52_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA52_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5CA52_BCL2L11      cggagagacctcccca----------------------------------
A0A2K5E1Q4_BMF-01       ctgacctgtttgcccagagcctactggactgc------------------
A0A2K5E1Q4_BMF-02       ctgacctgtttgcccagagcctactggactgc------------------
A0A2K5E6A6_BAD-03       gggacaggcc--cccaggctctggcaagc---------------------
A0A2K5E6A6_BAD-01       gggacaggcc--cccaggctctggcaagc---------------------
A0A2K5E6A6_BAD-02       gggacaggcc--cccaggctctggcaagc---------------------
A0A2K5BYA0_HRK-01       ccgcgcagct--c-------------------------------------
A0A2K5F6X4_BBC3-02      cggagcagca--cctggagtc-----------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      gagggcagct--ccccggagcccgtagagggcctggcccgcgacggcccg
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      cgccccttcccgctgccgcctgcgatgtttcccctcccgccgccacccgc
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      cgcaccgccgcctggccccgtggcctgggtgggtccccgcagccgccccc
                                                                          

A0A2K5CFK7_PMAIP1-      ---cttgaagtcgag-----------------------------------
A0A2K5CLG5_BIK-01       ---gcactggtcctg-----------------------------------
A0A2K5CA52_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA52_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA52_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA52_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA52_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA52_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA52_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA52_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA52_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5CA52_BCL2L11      ---gctcagacctgg-----------------------------------
A0A2K5E1Q4_BMF-01       ---cccctcagccgg-----------------------------------
A0A2K5E1Q4_BMF-02       ---cccctcagccgg-----------------------------------
A0A2K5E6A6_BAD-03       ---atccacgccagg-----------------------------------
A0A2K5E6A6_BAD-01       ---atccacgccagg-----------------------------------
A0A2K5E6A6_BAD-02       ---atccacgccagg-----------------------------------
A0A2K5BYA0_HRK-01       ---accgccgcccgg-----------------------------------
A0A2K5F6X4_BBC3-02      ---gcccgtgcccag----------------------------------c
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      gaggcccgcgcccggacgagagggcccggaggctcggaggaactggagac
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       ----------------------------------------cagctggcct
A0A2K5CA52_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA52_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA52_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA52_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA52_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA52_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA52_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA52_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA52_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5CA52_BCL2L11      -----------------------------------ggcccctacctccct
A0A2K5E1Q4_BMF-01       -------------------------------------cttcagctcttcc
A0A2K5E1Q4_BMF-02       -------------------------------------cttcagctcttcc
A0A2K5E6A6_BAD-03       -------------------------------------ccccaggcctccc
A0A2K5E6A6_BAD-01       -------------------------------------ccccaggcctccc
A0A2K5E6A6_BAD-02       -------------------------------------ccccaggcctccc
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      gccccgggggccctggcgggcggtcccacccaggcggccccgggagtccg
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      gccccgggggccctggcgggcggtcccacccaggcggccccgggagtccg
                                                                          

A0A2K5CFK7_PMAIP1-      ------tgtgccact---------------caactcaggagatttggaga
A0A2K5CLG5_BIK-01       gcatcgcggaccaga---------tggatgtgagccttagggcccggagg
A0A2K5CA52_BCL2L11      acagacagagccaca-----------------------------------
A0A2K5CA52_BCL2L11      acagacagagccaca-----------------------------------
A0A2K5CA52_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5CA52_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5CA52_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5CA52_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5CA52_BCL2L11      acagacagagccaca-----------------------------------
A0A2K5CA52_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5CA52_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5CA52_BCL2L11      acagacagagccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5E1Q4_BMF-01       ctctcacccactgct--------------gtggccctggccttcgaccca
A0A2K5E1Q4_BMF-02       ctctcacccactgct--------------gtggccctggccttcgaccca
A0A2K5E6A6_BAD-03       aggggacgc----ca--------------gtcaccagcagggacagccaa
A0A2K5E6A6_BAD-01       aggggacgc----ca--------------gtcaccagcagggacagccaa
A0A2K5E6A6_BAD-02       aggggacgc----ca--------------gtcaccagcagggacagccaa
A0A2K5BYA0_HRK-01       ---------------------------------ctcaaggcgctcggcga
A0A2K5F6X4_BBC3-02      cggggaggaggagca--------------gtgggcccgggagatcggggc
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      cggggaggaggagca--------------gtgggcccgggagatcggggc
                                                                          

A0A2K5CFK7_PMAIP1-      caaactaaatt---------------------------------------
A0A2K5CLG5_BIK-01       ctggcc--------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5CA52_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5CA52_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5CA52_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5CA52_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5CA52_BCL2L11      acagctgcccccacggcag-------------------------------
A0A2K5E1Q4_BMF-01       ccagcc--------------------------------------------
A0A2K5E1Q4_BMF-02       ccagcc--------------------------------------------
A0A2K5E6A6_BAD-03       ccagcagcagccaccatggaggtgagtactccacttgtgcctctgcttcc
A0A2K5E6A6_BAD-01       ccagcagcagccaccatggaggcgc-------------------------
A0A2K5E6A6_BAD-02       ccagcagcagccaccatgg-------------------------------
A0A2K5BYA0_HRK-01       cgagctgc------------------------------------------
A0A2K5F6X4_BBC3-02      ccagctgcggc---------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ccagctgcggc---------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5CA52_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5CA52_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5CA52_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5CA52_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5CA52_BCL2L11      ----------ccctcagggcccgctggccccaccggccagccctggccct
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       tcatctgagaatcccagtgcaaggatgctctcgaaagcatcagcagggat
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5CA52_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5CA52_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5CA52_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5CA52_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5CA52_BCL2L11      tttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgct
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       gtccgccccagccactgactcagaaaatgtaaagctggaggtgccttgct
A0A2K5E6A6_BAD-01       -----------------------------tggggctgtggagacc---cg
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      ------------------------------------------------gg
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ------------------------------------------------gg
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       ---------------------------------------cagctctatga
A0A2K5CA52_BCL2L11      ------------------------------------agaca---------
A0A2K5CA52_BCL2L11      ------------------------------------agaca---------
A0A2K5CA52_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5CA52_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5CA52_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5CA52_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5CA52_BCL2L11      ------------------------------------agaca---------
A0A2K5CA52_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5CA52_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5CA52_BCL2L11      gtctcgatcctccagtgggtatttctcttttgacacagaca---------
A0A2K5E1Q4_BMF-01       --------------------------------aggaagacaag-------
A0A2K5E1Q4_BMF-02       --------------------------------aggaagacaag-------
A0A2K5E6A6_BAD-03       gggtcgccacagctcctaccccgcagggacggaggaggacgaagggatgg
A0A2K5E6A6_BAD-01       aagtcgccacagctcctaccccgcagggacggaggaggacgaagggatgg
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------accagcgcacca
A0A2K5F6X4_BBC3-02      atggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagca
A0A2K5F6X4_BBC3-01      -----------------------------------gagacaagaggagca
A0A2K5F6X4_BBC3-03      atggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagca
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------tccggc------
A0A2K5CLG5_BIK-01       ggtggccatgtacagcccgggtctcgctttcatcctcgaccggaccgaca
A0A2K5CA52_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaatcaacacaaac
A0A2K5CA52_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaatcaacacaaac
A0A2K5CA52_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaatcaacacaaac
A0A2K5CA52_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaatcaacacaaac
A0A2K5CA52_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaatcaacacaaac
A0A2K5CA52_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaatcaacacaaac
A0A2K5CA52_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaatcaacacaaac
A0A2K5CA52_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaatcaacacaaac
A0A2K5CA52_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaatcaacacaaac
A0A2K5CA52_BCL2L11      ----ggagcccagcaccc------atgagttgtgacaaatcaacacaaac
A0A2K5E1Q4_BMF-01       ----gctacccagaccctca-----------------gcccagcctcccc
A0A2K5E1Q4_BMF-02       ----gctacccagaccctca-----------------gcccagcctcccc
A0A2K5E6A6_BAD-03       aggaggagcccagcccct----ttcggggccgttcgcgctcagcaccccc
A0A2K5E6A6_BAD-01       aggaggagcccagcccct----ttcggggccgttcgcgctcagcaccccc
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5BYA0_HRK-01       tgtggcggcgccgcgcgcggagccggagggcgccagcgcccggcgcgctc
A0A2K5F6X4_BBC3-02      -gccgcagcaccgcccctcaccctggagg--------gtcctgtacaatc
A0A2K5F6X4_BBC3-01      -gccgcagcaccgcccctcaccctggagg--------gtcctgtacaatc
A0A2K5F6X4_BBC3-03      -gccgcagcaccgcccctcaccctggagg--------gtcctgtacaatc
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       tcggggatgttcttagcggtatcgtgg-----aagttttcgctaacttcc
A0A2K5CA52_BCL2L11      cc------------------------------------------------
A0A2K5CA52_BCL2L11      cc------------------------------------------------
A0A2K5CA52_BCL2L11      cc------------------------------------------------
A0A2K5CA52_BCL2L11      cc------------------------------------------------
A0A2K5CA52_BCL2L11      cc------------------------------------------------
A0A2K5CA52_BCL2L11      cc------------------------------------------------
A0A2K5CA52_BCL2L11      cc------------------------------------------------
A0A2K5CA52_BCL2L11      cc------------------------------------------------
A0A2K5CA52_BCL2L11      cc------------------------------------------------
A0A2K5CA52_BCL2L11      cc------------------------------------------------
A0A2K5E1Q4_BMF-01       cagccaaggtgtcatgctgccttgtgg-----------------------
A0A2K5E1Q4_BMF-02       cagccaaggtgtcatgctgccttgtgg-----------------------
A0A2K5E6A6_BAD-03       caacctctgggcagcacagcgctatggccgcgagctccggaggatga---
A0A2K5E6A6_BAD-01       caacctctgggcagcacagcgctatggccgcgagctccggaggatgagtg
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5BYA0_HRK-01       cccac---------------------------------------------
A0A2K5F6X4_BBC3-02      tcatca--------------------------------------------
A0A2K5F6X4_BBC3-01      tcatca--------------------------------------------
A0A2K5F6X4_BBC3-03      tcatca--------------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      ---------------------agaaacttctgaatc--------------
A0A2K5CLG5_BIK-01       aggaggacatagtgaggctctggagatccctgagct--------------
A0A2K5CA52_BCL2L11      ---------------------caagtcctccttgcc--------------
A0A2K5CA52_BCL2L11      ---------------------caagtcctccttgcc--------------
A0A2K5CA52_BCL2L11      ---------------------caagtcctccttgcc--------------
A0A2K5CA52_BCL2L11      ---------------------caagtcctccttgcc--------------
A0A2K5CA52_BCL2L11      ---------------------caagtcctccttgcc--------------
A0A2K5CA52_BCL2L11      ---------------------caagtcctccttgcc--------------
A0A2K5CA52_BCL2L11      ---------------------caagtcctccttgcc--------------
A0A2K5CA52_BCL2L11      ---------------------caagtcctccttgcc--------------
A0A2K5CA52_BCL2L11      ---------------------caagtcctccttgcc--------------
A0A2K5CA52_BCL2L11      ---------------------caagtcctccttgcc--------------
A0A2K5E1Q4_BMF-01       ----ggtgactgaggaaccccagcgactcttttacggcaatgctggctat
A0A2K5E1Q4_BMF-02       ----ggtgactgaggaaccccagcgactcttttacg--------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       acgagtttgtggactcctttaagggacttcctcgcc--------------
A0A2K5E6A6_BAD-02       ---------------------agggacttcctcgcc--------------
A0A2K5BYA0_HRK-01       --------------------------ctactggccc--------------
A0A2K5F6X4_BBC3-02      ---------------------tgggactcctgccct--------------
A0A2K5F6X4_BBC3-01      ---------------------tgggactcctgccct--------------
A0A2K5F6X4_BBC3-03      ---------------------tgggactcctgccct--------------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5E1Q4_BMF-01       cggcttcctctccctgccagtttcccagcagtcttgccccttggggagca
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5E1Q4_BMF-01       gccccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaa
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-02       --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       ---------------------------------------ccgggtcctgg
A0A2K5CA52_BCL2L11      ------------------------------------------aggccttc
A0A2K5CA52_BCL2L11      ------------------------------------------aggccttc
A0A2K5CA52_BCL2L11      ------------------------------------------aggccttc
A0A2K5CA52_BCL2L11      ------------------------------------------aggccttc
A0A2K5CA52_BCL2L11      ------------------------------------------aggccttc
A0A2K5CA52_BCL2L11      ------------------------------------------aggccttc
A0A2K5CA52_BCL2L11      ------------------------------------------aggccttc
A0A2K5CA52_BCL2L11      ------------------------------------------aggccttc
A0A2K5CA52_BCL2L11      ------------------------------------------aggccttc
A0A2K5CA52_BCL2L11      ------------------------------------------aggccttc
A0A2K5E1Q4_BMF-01       agcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacat
A0A2K5E1Q4_BMF-02       -----------------------------------------------cat
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       -------------------------------------cgaagagcgcggg
A0A2K5E6A6_BAD-02       -------------------------------------cgaagagcgcggg
A0A2K5BYA0_HRK-01       -------------------------------------tggctgtgcgcgg
A0A2K5F6X4_BBC3-02      -------------------------------------ttcccaggggcca
A0A2K5F6X4_BBC3-01      -------------------------------------ttcccaggggcca
A0A2K5F6X4_BBC3-03      -------------------------------------ttcccaggggcca
                                                                          

A0A2K5CFK7_PMAIP1-      ---------------------------------------tgatatccaaa
A0A2K5CLG5_BIK-01       gtgtcccgcaaacaggcagt-------------gctgctggcactcctgg
A0A2K5CA52_BCL2L11      aaccactatctcagtgcaat------------gggtgatat---ttcatt
A0A2K5CA52_BCL2L11      aaccactatctcagtgcaat------------ggatgaggccactgaatc
A0A2K5CA52_BCL2L11      aaccactatctcagtgcaat------------ggtt--------------
A0A2K5CA52_BCL2L11      aaccactatctcagtgcaat------------------------------
A0A2K5CA52_BCL2L11      aaccactatctcagtgcaat------------ggcttccatgaggcaatc
A0A2K5CA52_BCL2L11      aaccactatctcagtgcaat------------ggcttccatgaggcaatc
A0A2K5CA52_BCL2L11      aaccactatctcagtgcaat------------ggcttccatgaggcaatc
A0A2K5CA52_BCL2L11      aaccactatctcagtgcaat------------ggcttccatgaggcaatc
A0A2K5CA52_BCL2L11      aaccactatctcagtgcaat------------ggcttccatgaggcaatc
A0A2K5CA52_BCL2L11      aaccactatctcagtgcaat------------ggct--------------
A0A2K5E1Q4_BMF-01       cagcagaaccgaaatcgcgt----------gtggtggcaggtcctcctct
A0A2K5E1Q4_BMF-02       cagcagaaccgaaatcgcgt----------gtggtggcaggtcctcctct
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       cacagcaacgcagatgcggcaaagctccagttggacgcaagtcatccagt
A0A2K5E6A6_BAD-02       cacagcaacgcagatgcggcaaagctccagttggacgcaagtcatccagt
A0A2K5BYA0_HRK-01       ccgcgc-----aggtggcgg------c--gctggcggcctg---------
A0A2K5F6X4_BBC3-02      cagagcccccgagatggagc------ccaattag----------------
A0A2K5F6X4_BBC3-01      cagagcccccgagatggagc------ccaattaggtgcctgcacccgccc
A0A2K5F6X4_BBC3-03      cagagcccccgagatggagc------ccaattaggtgcctgcacccgccc
                                                                          

A0A2K5CFK7_PMAIP1-      ctcttctgctcaggaacctga-----------------------------
A0A2K5CLG5_BIK-01       cgctgctg-------------------------------------ctggc
A0A2K5CA52_BCL2L11      gtggtttagatttatatttaccttctttgatttgtatggccaccaccaca
A0A2K5CA52_BCL2L11      ctcccttggaattgc---ccttcgtaggga--ggttcagtggccacttga
A0A2K5CA52_BCL2L11      ---------------------------aga--gaaataga------ggaa
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      tcaggctgaacctgcaggtatgcgcccgga--gatatggatcgcccaaga
A0A2K5CA52_BCL2L11      tcaggctgaacctgcaggtatgcgcccgga--gatatggatcgcccaaga
A0A2K5CA52_BCL2L11      tcaggctgaacctgcaggtatgcgcccgga--gatatggatcgcccaaga
A0A2K5CA52_BCL2L11      tcaggctgaacctgcaggtatgcgcccgga--gatatggatcgcccaaga
A0A2K5CA52_BCL2L11      tcaggctgaacctgcaggtatgcgcccgga--gatatggatcgcccaaga
A0A2K5CA52_BCL2L11      ---gact-------------------------------------------
A0A2K5E1Q4_BMF-01       ttctgcacaacctggctttgaatggagaa---------------------
A0A2K5E1Q4_BMF-02       ttctgcacaacctggctttgaatggagaa---------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       cctggtgggatcggaacttg------------------------------
A0A2K5E6A6_BAD-02       cctggtgggatcggaacttg------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      ggtggacgtcagggactcggggggcaggcc--cctcccacctcctgacac
A0A2K5F6X4_BBC3-03      ggtggacgtcagggactcggggggcaggcc--cctcccacctcctgacac
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       gatgttcagcgggggtctgcacctgctgctcaagtga-------------
A0A2K5CA52_BCL2L11      gtcaaggtacag----aacaactccaccac--------------aagtat
A0A2K5CA52_BCL2L11      gtggt----tagcaaaatcaagctga------------------------
A0A2K5CA52_BCL2L11      gttgtcgtgtag--------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------gggtat
A0A2K5CA52_BCL2L11      gttgcggcgtatcggagacgagtttaacgcttattatccaaggagggtat
A0A2K5CA52_BCL2L11      gttgcggcgtatcggagacgagtttaacgcttattatccaaggagggtat
A0A2K5CA52_BCL2L11      gttgcggcgtatcggagacgagtttaacgcttattatccaaggagggtat
A0A2K5CA52_BCL2L11      gttgcggcgtatcggagacgagtttaacgcttattatccaaggaggatat
A0A2K5CA52_BCL2L11      gttgcggcgtatcggagacgagtttaacgcttattatccaaggaggtta-
A0A2K5CA52_BCL2L11      --------------gggactag----------------------------
A0A2K5E1Q4_BMF-01       -------gagaacaggaatggggcaggcccgaggtga-------------
A0A2K5E1Q4_BMF-02       -------gagaacaggaatggggcaggcccgag-----------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       -------ggcaggggaggctccgctccctcccagtga-------------
A0A2K5E6A6_BAD-02       -------ggcaggggaggctccgctccctcccagtgaccttcgctccaca
A0A2K5BYA0_HRK-01       gctgctcggcaggcggaact------------tgtag-------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      cctggccagcgcgggggactttctctgcaccatgtag-------------
A0A2K5F6X4_BBC3-03      cctggccagcgcgggggactttctctgcaccatgtag-------------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA52_BCL2L11      ttctcatga-----------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      tttt-------gaataa---------------------------------
A0A2K5CA52_BCL2L11      tttt-------gaataattaccaagcagccgaagaccacccacacatggt
A0A2K5CA52_BCL2L11      tttt-------gaataattaccaagcagccgaagaccacccacacatggt
A0A2K5CA52_BCL2L11      tttt-------gaataattaccaagcagccgaagaccacccacacatggt
A0A2K5CA52_BCL2L11      ctcttccatctgattga---------------------------------
A0A2K5CA52_BCL2L11      -----------gagaaatag------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-02       tcccgaaactccacccgttcccatcgccttgggcggccatcttggatatg
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      tatcttacgactgttacgttacattgtccgcctggtgtggagaatgcatt
A0A2K5CA52_BCL2L11      tatcttacgactgttacgttacattgtccgcctggtgtggagaatgcatt
A0A2K5CA52_BCL2L11      tatcttacgactgttacgttacattgtccgcctggtgtggagaatgcatt
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-02       ggcggaagtgcttcctgcagggagagctgacccagattcccttccggtgc
A0A2K5BYA0_HRK-01       --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5CFK7_PMAIP1-      ------
A0A2K5CLG5_BIK-01       ------
A0A2K5CA52_BCL2L11      ------
A0A2K5CA52_BCL2L11      ------
A0A2K5CA52_BCL2L11      ------
A0A2K5CA52_BCL2L11      ------
A0A2K5CA52_BCL2L11      ga----
A0A2K5CA52_BCL2L11      ga----
A0A2K5CA52_BCL2L11      ga----
A0A2K5CA52_BCL2L11      ------
A0A2K5CA52_BCL2L11      ------
A0A2K5CA52_BCL2L11      ------
A0A2K5E1Q4_BMF-01       ------
A0A2K5E1Q4_BMF-02       ------
A0A2K5E6A6_BAD-03       ------
A0A2K5E6A6_BAD-01       ------
A0A2K5E6A6_BAD-02       gtgtga
A0A2K5BYA0_HRK-01       ------
A0A2K5F6X4_BBC3-02      ------
A0A2K5F6X4_BBC3-01      ------
A0A2K5F6X4_BBC3-03      ------
                              

© 1998-2021Legal notice