Dataset for CDS BBC3 of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5F6X4_BBC3-02      aaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcctagggc
A0A2K5F6X4_BBC3-01      aaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcctagggc
A0A2K5F6X4_BBC3-03      ---------------tctgcctgggcatgtccatgccaagtgcctagggc

A0A2K5F6X4_BBC3-02      ttcttcctcgacgtgggtcccctgccagatgtgtggtcc---------tc
A0A2K5F6X4_BBC3-01      ttcttcctcgacgtgggtcccctgccagatgtgt----------------
A0A2K5F6X4_BBC3-03      ttcttcctcgacgtgggtcccctgccagatgtgtggccccagggagcgcc

A0A2K5F6X4_BBC3-02      agccctcgctctcgctggcggagcagcacctggagtc-------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcct

A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ggcccgcgacggcccgcgccccttcccgctgccgcctgcgatgtttcccc

A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      tcccgccgccacccgccgcaccgccgcctggccccgtggcctgggtgggt

A0A2K5F6X4_BBC3-02      -------------------gcccgtgcccag-------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ccccgcagccgcccccgaggcccgcgcccggacgagagggcccggaggct

A0A2K5F6X4_BBC3-02      ---------------cgccccgggggccctggcgggcggtcccacccagg
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      cggaggaactggagacgccccgggggccctggcgggcggtcccacccagg

A0A2K5F6X4_BBC3-02      cggccccgggagtccgcggggaggaggagcagtgggcccgggagatcggg
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      cggccccgggagtccgcggggaggaggagcagtgggcccgggagatcggg

A0A2K5F6X4_BBC3-02      gcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcg
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      gcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcg

A0A2K5F6X4_BBC3-02      gagacaagaggagcagccgcagcaccgcccctcaccctggagggtcctgt
A0A2K5F6X4_BBC3-01      gagacaagaggagcagccgcagcaccgcccctcaccctggagggtcctgt
A0A2K5F6X4_BBC3-03      gagacaagaggagcagccgcagcaccgcccctcaccctggagggtcctgt

A0A2K5F6X4_BBC3-02      acaatctcatcatgggactcctgccctttcccaggggccacagagccccc
A0A2K5F6X4_BBC3-01      acaatctcatcatgggactcctgccctttcccaggggccacagagccccc
A0A2K5F6X4_BBC3-03      acaatctcatcatgggactcctgccctttcccaggggccacagagccccc

A0A2K5F6X4_BBC3-02      gagatggagcccaattag--------------------------------
A0A2K5F6X4_BBC3-01      gagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggac
A0A2K5F6X4_BBC3-03      gagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggac

A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      tcggggggcaggcccctcccacctcctgacaccctggccagcgcggggga
A0A2K5F6X4_BBC3-03      tcggggggcaggcccctcccacctcctgacaccctggccagcgcggggga

A0A2K5F6X4_BBC3-02      -------------------
A0A2K5F6X4_BBC3-01      ctttctctgcaccatgtag
A0A2K5F6X4_BBC3-03      ctttctctgcaccatgtag

© 1998-2022Legal notice