Dataset for CDS BBC3 of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5F6X4_BBC3-02      aaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcctagggc
A0A2K5F6X4_BBC3-01      aaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcctagggc
A0A2K5F6X4_BBC3-03      ---------------tctgcctgggcatgtccatgccaagtgcctagggc
                                       ***********************************

A0A2K5F6X4_BBC3-02      ttcttcctcgacgtgggtcccctgccagatgtgtggtcc---------tc
A0A2K5F6X4_BBC3-01      ttcttcctcgacgtgggtcccctgccagatgtgt----------------
A0A2K5F6X4_BBC3-03      ttcttcctcgacgtgggtcccctgccagatgtgtggccccagggagcgcc
                        **********************************                

A0A2K5F6X4_BBC3-02      agccctcgctctcgctggcggagcagcacctggagtc-------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcct
                                                                          

A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ggcccgcgacggcccgcgccccttcccgctgccgcctgcgatgtttcccc
                                                                          

A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      tcccgccgccacccgccgcaccgccgcctggccccgtggcctgggtgggt
                                                                          

A0A2K5F6X4_BBC3-02      -------------------gcccgtgcccag-------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ccccgcagccgcccccgaggcccgcgcccggacgagagggcccggaggct
                                                                          

A0A2K5F6X4_BBC3-02      ---------------cgccccgggggccctggcgggcggtcccacccagg
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      cggaggaactggagacgccccgggggccctggcgggcggtcccacccagg
                                                                          

A0A2K5F6X4_BBC3-02      cggccccgggagtccgcggggaggaggagcagtgggcccgggagatcggg
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      cggccccgggagtccgcggggaggaggagcagtgggcccgggagatcggg
                                                                          

A0A2K5F6X4_BBC3-02      gcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcg
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      gcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcg
                                                                          

A0A2K5F6X4_BBC3-02      gagacaagaggagcagccgcagcaccgcccctcaccctggagggtcctgt
A0A2K5F6X4_BBC3-01      gagacaagaggagcagccgcagcaccgcccctcaccctggagggtcctgt
A0A2K5F6X4_BBC3-03      gagacaagaggagcagccgcagcaccgcccctcaccctggagggtcctgt
                        **************************************************

A0A2K5F6X4_BBC3-02      acaatctcatcatgggactcctgccctttcccaggggccacagagccccc
A0A2K5F6X4_BBC3-01      acaatctcatcatgggactcctgccctttcccaggggccacagagccccc
A0A2K5F6X4_BBC3-03      acaatctcatcatgggactcctgccctttcccaggggccacagagccccc
                        **************************************************

A0A2K5F6X4_BBC3-02      gagatggagcccaattag--------------------------------
A0A2K5F6X4_BBC3-01      gagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggac
A0A2K5F6X4_BBC3-03      gagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggac
                        ******************                                

A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-01      tcggggggcaggcccctcccacctcctgacaccctggccagcgcggggga
A0A2K5F6X4_BBC3-03      tcggggggcaggcccctcccacctcctgacaccctggccagcgcggggga
                                                                          

A0A2K5F6X4_BBC3-02      -------------------
A0A2K5F6X4_BBC3-01      ctttctctgcaccatgtag
A0A2K5F6X4_BBC3-03      ctttctctgcaccatgtag
                                           

© 1998-2020Legal notice