Dataset for CDS classical BH3-containing proteins of organism Anser cygnoid

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9EVW2_BMF-01       atggatcgcc-ccagctacctggaagaggactattctagcctggatgggc
A0A8B9EN35_PMAIP1-      --------cttccag-----------------------------------
A0A8B9EP68_BCL2L11      atgaagccctgccagccgcc------------------gcccgg------
                                *  ****                                   

A0A8B9EVW2_BMF-01       tggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcct
A0A8B9EN35_PMAIP1-      --------------------------------------------------
A0A8B9EP68_BCL2L11      ------------------------------cccgtctcgcccggcagccc
                                                                          

A0A8B9EVW2_BMF-01       ggtgagatgactgcaacaggcattttcacacagaaccagtcctacagctg
A0A8B9EN35_PMAIP1-      -----ga-----gc-gca--------------------------------
A0A8B9EP68_BCL2L11      gccgcgg-----gc-gcagccgccgcccgccagccccggcccgttcgcca
                             *      **  **                                

A0A8B9EVW2_BMF-01       ccttctggggaggtttcaact--------atttcccctcacacactgctg
A0A8B9EN35_PMAIP1-      ---------------------------------tcctccacagcgggacg
A0A8B9EP68_BCL2L11      cccgctcgccgctcttcatcttccggctacttctccttcgaggccgagcg
                                                          **  *          *

A0A8B9EVW2_BMF-01       tggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaacac
A0A8B9EN35_PMAIP1-      c-------------------------------------------------
A0A8B9EP68_BCL2L11      cagccccgcgccca-------tgagctgc--gacaaggccacgcagaccc
                                                                          

A0A8B9EVW2_BMF-01       tcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcact
A0A8B9EN35_PMAIP1-      --------------------------------------------------
A0A8B9EP68_BCL2L11      ccagcccgccct------gccaggccgtca-----------gccactacc
                                                                          

A0A8B9EVW2_BMF-01       gaagagccccggagactcttctatgggaacgctggttaccgtttacacgt
A0A8B9EN35_PMAIP1-      --------------------------------------------------
A0A8B9EP68_BCL2L11      tgagcgccatgg--------------------------------------
                                                                          

A0A8B9EVW2_BMF-01       ccctccagttggctttgcattggatccacacctccaagaggagcctcagg
A0A8B9EN35_PMAIP1-      -------ggtggc----------------------------gg-------
A0A8B9EP68_BCL2L11      -cttccaggtggc----------------------------ggtctcact
                               * ****                             *       

A0A8B9EVW2_BMF-01       aaggtcagcaggaggcgcgtgcggaggtgcagattgcacggaagttgcag
A0A8B9EN35_PMAIP1-      -------------agtgc-----------------gcgctggagctgcgc
A0A8B9EP68_BCL2L11      tgctagcagaagaaatacagccagaaatatggattgcacaggagctgcgg
                                         *                 ** * * ** ***  

A0A8B9EVW2_BMF-01       tgcattgcagaccagttccaccggctccacatacagaggcatcagcagaa
A0A8B9EN35_PMAIP1-      aggatcggcga------caaggcggacctgcgacagagg-----------
A0A8B9EP68_BCL2L11      cgcattggagatgaattcaatgcctcctattgtccgaga-----------
                         * ** *  **      * *      *      * ***            

A0A8B9EVW2_BMF-01       cagaaatcaagtgtggtggcagctttttctctttctacacaacttggcct
A0A8B9EN35_PMAIP1-      ---------a-------------------------------tcctgaacc
A0A8B9EP68_BCL2L11      ---------agggtaattttcttatttttactttccat-ttctttacact
                                 *                                  *   * 

A0A8B9EVW2_BMF-01       taaatgtggaggcg---------------aacaggaaccacactgggcag
A0A8B9EN35_PMAIP1-      tcatcgcaaagctg----ttctgccccaaaac------------------
A0A8B9EP68_BCL2L11      taatcgttattctgcgcctcctgcattatatcatccgcctcatctggagg
                        * *  *       *               * *                  

A0A8B9EVW2_BMF-01       ag---gtga
A0A8B9EN35_PMAIP1-      -----gtga
A0A8B9EP68_BCL2L11      atgcagtga
                             ****

© 1998-2022Legal notice