Dataset for CDS classical BH3-containing proteins of organism Anas platyrhynchos platyrhynchos

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

U3IW89_BCL2L11-01       ---ggcggcgctggtaaacacg-gggcggggacgg-----gacgggacgg
A0A493SWX7_PMAIP1-      atg--ccgtgcaggaccctgcgcaaacctgcacaaccctccgcagaacgg
A0A493T7X1_BMF-01       atggatcgccccag---ctacctggaagaggactattctagcctggatgg
A0A493T7X1_BMF-02       atggatcgccccag---ctacctggaagaggactattctagcctggatgg
                               *  *  *      *        * **         * * * **

U3IW89_BCL2L11-01       gaggggcgg-------------------------gcagcggcagccccga
A0A493SWX7_PMAIP1-      --caggcggtggcggagtgcgcgc---------tggagctgc--gccgga
A0A493T7X1_BMF-01       gctggacgatgacgtgtttcactctgatgactttggacttgcaggtcagc
A0A493T7X1_BMF-02       gctggacgatgacgtgtttcactctgatgactttggacttgcaggtcagc
                            * **                          * *   **    * * 

U3IW89_BCL2L11-01       gcg---------cggtcgccgctgctgtcgcgc--------tcctccagc
A0A493SWX7_PMAIP1-      tcggcgacaaggcgg--------actttcg---------------acagc
A0A493T7X1_BMF-01       ctggtgagatgactgcaacaggcattttcacacagaaccagtcctacagc
A0A493T7X1_BMF-02       ctggtgagatgactgcaacaggcattttcacacagaaccagtcctacagc
                          *         * *          * **                 ****

U3IW89_BCL2L11-01       gg-------------------ctacttctccttcgaggccgagcgcagcc
A0A493SWX7_PMAIP1-      gg------------------------------------------------
A0A493T7X1_BMF-01       tgccttctggggaggtttcaactatttcccctcacacactgctgtggtcc
A0A493T7X1_BMF-02       tgccttctggggaggtttcaactatttcccctcacacactgctgtggtcc

U3IW89_BCL2L11-01       ccgcgcc------catgagctgc--gacaaggccacgcagacccccagcc
A0A493SWX7_PMAIP1-      -----------atcctgaacctcatcacaaagctgttc------------
A0A493T7X1_BMF-01       cggtgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcc
A0A493T7X1_BMF-02       cggtgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcc
                                     * *** *  *   **** **    *            

U3IW89_BCL2L11-01       cgccct------gccaggccgtcagccactacctgagcgccatggcttcc
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A493T7X1_BMF-01       cgtcctcttccagtcaggatgtta----------------------tgtt
A0A493T7X1_BMF-02       cgtcctcttccagtcaggatgtta----------------------tgtt

U3IW89_BCL2L11-01       aggtggcggtctcactcgctagcagaagaaatacagcca-----------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A493T7X1_BMF-01       gccttgtggagtcactgaagagccccggagactcttctat----------
A0A493T7X1_BMF-02       gccttgtggagtcactgaagagccccggagactcttctatgggaatgctg

U3IW89_BCL2L11-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       gttaccgtttacatgtccctccagttggctttgcattggatccacacctc

U3IW89_BCL2L11-01       ---------------------------------------gaaatatggat
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       caagaggagcctcaggaaggtcagcaggaggcgcgtgctgaggtgcagat

U3IW89_BCL2L11-01       tgcacaggagctgcggcgcattggagatgaattcaatgcctcct------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       tgcacggaagttgcagtgcattgcagaccagttccaccggctccacatac

U3IW89_BCL2L11-01       ---------------------attgtccaagaagggtaattttcttattt
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A493T7X1_BMF-01       ----gcatcagcagaacagaaatcaagtgtggtggcagctttttctcttt
A0A493T7X1_BMF-02       agaggcatcagcagaacagaaatcaagtgtggtggcagctttttctcttt

U3IW89_BCL2L11-01       ttactttccatttctttacacttagtgccacgtctacctccacctttccc
A0A493SWX7_PMAIP1-      ----------tgccccaaaacgtga-------------------------
A0A493T7X1_BMF-01       ctacacaacttggccttaaacgtggag-----------------------
A0A493T7X1_BMF-02       ctacacaacttggccttaaacgtggag-----------------------
                                  *  *   * ** *                           

U3IW89_BCL2L11-01       gcgtccaggcagtgttgcaggaggtgtttgtctcgtgggtgctgtgcagt
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A493T7X1_BMF-01       gcgaacaggaacc-------------------------acactgggcaga
A0A493T7X1_BMF-02       gcgaacaggaacc-------------------------acactgggcaga

U3IW89_BCL2L11-01       tgggaattaaagtcactttttttaccctgttttccttctag---------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A493T7X1_BMF-01       ggtgagcttcacccacctgtttcaggccacatccagtctgcagggagcac
A0A493T7X1_BMF-02       ggtga---------------------------------------------

U3IW89_BCL2L11-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A493T7X1_BMF-01       tgaacaaacactggttcgggggagagacatgcacaccgccggccggatgt
A0A493T7X1_BMF-02       --------------------------------------------------

U3IW89_BCL2L11-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A493T7X1_BMF-01       gaggactctgaaattcttctactcgtcttcaagtttggggttttatggac
A0A493T7X1_BMF-02       --------------------------------------------------

U3IW89_BCL2L11-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A493T7X1_BMF-01       tcctctttgctgctccctgccctgcgaggcagggagctcttgtccaacac
A0A493T7X1_BMF-02       --------------------------------------------------

U3IW89_BCL2L11-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A493T7X1_BMF-01       tgtcgaaggaaagccagaatgtgggtgtgtttggtaaagcttgctgctgg
A0A493T7X1_BMF-02       --------------------------------------------------

U3IW89_BCL2L11-01       ------------------------------------------------
A0A493SWX7_PMAIP1-      ------------------------------------------------
A0A493T7X1_BMF-01       gtccccgcaccggtaacctctgtgcaggagaggcaggtattaggctaa
A0A493T7X1_BMF-02       ------------------------------------------------

© 1998-2022Legal notice