Dataset for CDS PMAIP1 of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7N5JEA5_PMAIP1-      a-----tgcctgggaagaaagcgcgtaagagcgcgcaggcgagtcctgcg
G1LIZ7_PMAIP1-01        atcggctccctgctcagtggg-------gagcctgc-------ttctccc
                        *     * ****   **   *       ****  **       * ** * 

A0A7N5JEA5_PMAIP1-      cggaccccggcagag------cccgaagtggagtgcgccattcaactcag
G1LIZ7_PMAIP1-01        tctccctctgccgcaccccctcccgaagtggagtgcgccattcaactcag
                            ** * ** *        *****************************

A0A7N5JEA5_PMAIP1-      gagatttggagacaaactgaatttccggcagaaacttctgaatctgatat
G1LIZ7_PMAIP1-01        gagatttggagacaaactgaatttccggcagaaacttctgaatctgatat
                        **************************************************

A0A7N5JEA5_PMAIP1-      ccaaactcttccgctcaggaacctga
G1LIZ7_PMAIP1-01        ccaaactcttccgctcaggaacctga
                        **************************

© 1998-2022Legal notice