Dataset for CDS classical BH3-containing proteins of organism Acanthochromis polyacanthus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1FVH7_BMF-01       ---------------------------------atggacgatgaggagga
A0A3Q1FVH7_BMF-02       ---------------------------------atggacgatgaggagga
A0A3Q1ELG4_BCL2L11      agctccagcgctgcttcacccgcggctccacatgcagacactacagaggg
A0A3Q1GWH9_BAD-01       ------atggctgcaaaattctcaatttca------------------ga

A0A3Q1FVH7_BMF-01       tgatgtgtttgagccagacacccactgctggcgcacaacattcagggaga
A0A3Q1FVH7_BMF-02       tgatgtgtttgagccagacacccactgctggcgcacaacattcagggaga
A0A3Q1ELG4_BCL2L11      cggcggagcggatccagaacccgtcggtgcagctggagtctcggcgaaaa
A0A3Q1GWH9_BAD-01       cggcgactcagagccaga----------ggaagtggag----ggagaaaa
                         *  *     ** *****                  *        * * *

A0A3Q1FVH7_BMF-01       taaagtgtgaa-----gaccggggcaca--cagactcctg----------
A0A3Q1FVH7_BMF-02       taaagtgtgaa-----gaccggggcaca--cagactcctg----------
A0A3Q1ELG4_BCL2L11      catcccgttcgaactccaccggaggagagccggactcccc----------
A0A3Q1GWH9_BAD-01       ca-accattcaccagcaacagaagccatgcctgtcttcgcccgccgcaac
                         *     *         ** *  *      * * ** *            

A0A3Q1FVH7_BMF-01       --gtcctgccctacaaccaa-acaacggcatgctgccctgtggagtcg--
A0A3Q1FVH7_BMF-02       --gtcctgccctacaaccaa-acaacggcatgctgccctgtggagtcg--
A0A3Q1ELG4_BCL2L11      --gtcctggtccagagccag--cctaggcgtgt-ttcagaccaggtcgat
A0A3Q1GWH9_BAD-01       atggccttacctgaactcagaaccccagcatctggtcggatcaggctga-
                          * ***   *   *  **   *    ** *     *       *  *  

A0A3Q1FVH7_BMF-01       -cagaggagcccagaccactc--ttctacggtaacgcaggttttc-----
A0A3Q1FVH7_BMF-02       -cagaggagcccagaccactc--ttctacggtaacgcaggttttc-----
A0A3Q1ELG4_BCL2L11      atttcacctccctcgccgc----tcctccagtggtta----tttc-----
A0A3Q1GWH9_BAD-01       actcggagtcccacgcctccacgctctccagagatgaggagctccaggca
                                 ***   ** *      ** * *           * *     

A0A3Q1FVH7_BMF-01       -----------gactgcacttcccagcacactttgagcttattgcgaggc
A0A3Q1FVH7_BMF-02       -----------gactgcacttcccagcacactttgagcttattgcgaggc
A0A3Q1ELG4_BCL2L11      --------------------tccgccgatggttccgactcggtgccgagc
A0A3Q1GWH9_BAD-01       aagggggaagaggaagccggcacgcccacagagggagctccgttcagggc
                                              *    *         **   * *   **

A0A3Q1FVH7_BMF-01       aacaaggaagtgaaatggagcaaaatgggatggagcagctgccccggcag
A0A3Q1FVH7_BMF-02       aacaaggaagtgaaatggagcaaaatgggatggagcagctgccccggcag
A0A3Q1ELG4_BCL2L11      ------------------------tc--------cccgctctcaccgaag
A0A3Q1GWH9_BAD-01       ------------------------acggtctaagtcggctccccctgc--
                                                           * ***  * * *   

A0A3Q1FVH7_BMF-01       caacctatggcacacagcgtggaggcttgcattggaca-gaaactccagc
A0A3Q1FVH7_BMF-02       caacctatggcacacagcgtggaggcttgcattggaca-gaaactccagc
A0A3Q1ELG4_BCL2L11      cggctgacggctgacaaaa----------------ccacgcaaactccga
A0A3Q1GWH9_BAD-01       --gctgtgggccgccaagaagta---------cggcca-gcagctccgaa
                           *    ***   **                    ** * *    *   

A0A3Q1FVH7_BMF-01       tgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaac
A0A3Q1FVH7_BMF-02       tgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaac
A0A3Q1ELG4_BCL2L11      gcccgagcggccaggtgatcag------------------ac------ac
A0A3Q1GWH9_BAD-01       ggatgagcgacgagtttgacag------------------cctgctagac
                              * * * ** *   * *                   *      **

A0A3Q1FVH7_BMF-01       caaaggaaccaggggccgctgtggtggcgcctggtcgcagccattctcag
A0A3Q1FVH7_BMF-02       caaaggaaccaggggccgctgtggtggcgcctggtcgcagccattctcag
A0A3Q1ELG4_BCL2L11      gcactggagcgcatg--gccggtgaggcgcacagaggaggac---cggag
A0A3Q1GWH9_BAD-01       aaaggggag---atgaagagagtgaggagcgcagggacggccagacagat
                          *  * *      *  *     * ** **   *     * *   *  * 

A0A3Q1FVH7_BMF-01       ccttctgtttgacggggggt----------------tcattgctggagga
A0A3Q1FVH7_BMF-02       ccttctgtttgacggggggt----------------tcattgctggagga
A0A3Q1ELG4_BCL2L11      acgcagcggcagcagcacggtgagctg-------aatgactgcaggagct
A0A3Q1GWH9_BAD-01       gcaccactctaaaagctggtggagctacctctttagtcac--caggagat
                         *            *   *                 * *   * ****  

A0A3Q1FVH7_BMF-01       ggtggtgcaggacgg-----------------------------------
A0A3Q1FVH7_BMF-02       ggtggtgcaggacgg-----------------------------------
A0A3Q1ELG4_BCL2L11      gcggacaaaggaaaaccagtttgacattctctgcagtagtttttgctctc
A0A3Q1GWH9_BAD-01       ggagggagagaacaaccaccatgaaa------------------------
                        *  *    ** *                                      

A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3Q1ELG4_BCL2L11      gccattgtctgtccttgtcttctgtcatttttgttcactgtttgctttcg
A0A3Q1GWH9_BAD-01       gcca----------------------------------------------

A0A3Q1FVH7_BMF-01       -------------------aggtga
A0A3Q1FVH7_BMF-02       -------------------aggtga
A0A3Q1ELG4_BCL2L11      tttctgcaacaaacgagttaaataa
A0A3Q1GWH9_BAD-01       ------cacacatcgcaatgagtag

© 1998-2022Legal notice